Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Explanation:
Large amounts of heat are needed to evaporate water, because H-bonds need to be broken. Sweating is an example of using water as d coolant. As the sweat evaporates it pulls heat away from the body. Application 'Water's thermal properties, its high specific heat, means that it can cool us.
Answer:
Protons, neutrons, and electrons: Both protons and neutrons have a mass of 1 amu and are found in the nucleus. However, protons have a charge of +1, and neutrons are uncharged. Electrons have a mass of approximately 0 amu, orbit the nucleus, and have a charge of -1.
Explanation:
A combination of two or more metals is called and Alloy.
Easy answer: its too hot.
The deepest man made hole is Kola Superdeep Borehole. That was a Russian experiment to see how deep you could drill into earths crust, reaching down 12,262 meters. At that depth the temperature reached 180 °C. The scientists estimated that a 15,000 meters depth the temperature would reach 300 °C, and at that temperature the drill would cease to work and the project was stopped.
