1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
10

Human skin color varies widely around the world, and children do not always exhibit the exact same coloring as their parents. Ba

sed on this information, what is true about human skin color?
A.Skin color is not a genetic trait.
B.A single pair of alleles controls this trait.
C.It’s an example of incomplete dominance.
D.It’s an example of polygenic inheritance.
Biology
2 answers:
Alina [70]3 years ago
7 0
D, it is polygenetic inheritance. <span />
Mnenie [13.5K]3 years ago
5 0

Answer:

D.It’s an example of polygenic inheritance.

Explanation:

Polygenic inheritance occurs when more than one gene regulate single genetic trait. Human skin color is regulated by more than one gene and follows quantitative inheritance wherein total number of dominant alleles of all genes determine the skin color. Formation of various gene combinations by multiple genes regulating the skin color results in world wide variation of the trait as well as variations of skin color between parent and progeny.

You might be interested in
If a disease strikes the snake population in the food chain shown, what will be the initial effect on the populations of hawks a
Ilya [14]

Answer:

The hawk population will drop while the rabbit population will rise.

Explanation:

With the way the pyramid is structured, it shows that the rabbits eat grass, snakes eat the rabbits, and hawks eat the snakes. If the snakes are gone, the hawks will lose a food source, and their population will drop. Also, the rabbit population will rise, because the snakes eat the rabbits, and if the snakes are gone, they won't have any predators.

5 0
2 years ago
Read 2 more answers
Which of the following is made by male plant cells and is important for the reproduction of flowering plants?
Natasha_Volkova [10]
Pollen is made by the male part.
3 0
3 years ago
PLEASE I'M DOOMED IF YOU DON'T ANSWER THIS PLEASEEEEE!!! combat climate change with artificial inteligence ' pls give me subtopi
gayaneshka [121]

Answer:

<h3><em><u>Subtopics</u></em><em><u> </u></em><em><u>:</u></em><em><u>-</u></em></h3>

<em>(</em><em>Related</em><em> </em><em>to</em><em> </em><em>topic</em><em> </em><em>"</em><em>Climate</em><em> </em><em>change</em><em> </em><em>with</em><em> </em><em>artificial</em><em> </em><em>intelligence</em><em>"</em><em>)</em>

  • Introduction
  • How can AI help combat climate change?
  • Advantages of AI in combat climate change.
  • Disadvantages of AI in combat climate change.
  • Conclusion
5 0
3 years ago
Which of the following is a process in which carbon is released back into the atmosphere?
bagirrra123 [75]
Each time you exhale, you are releasing carbon dioxide gas (CO2) into the atmosphere. Animals and plants get rid of carbon dioxide gas through a process called respiration. Carbon moves from fossil fuels to the atmosphere when fuels are burned.
4 0
3 years ago
The first organisms evolved on Earth around 4 billion years ago. The fossil record indicates that the first organisms were which
Irina-Kira [14]
Prokaryotes were the first

6 0
3 years ago
Read 2 more answers
Other questions:
  • C) Why are vaccines important in preventing infections of more dangerous viruses?
    15·1 answer
  • Which is the best definition of a phylogenetic tree? A) a table of classification that is based only on physical characteristics
    9·1 answer
  • The phase of mitosis shown in step D in the figure below is called ______________________.
    9·2 answers
  • Why can an exogenous protein, protein that is added by experimentalists that has the same amino acid sequence as endogenous prot
    12·1 answer
  • Why do leaves appear green?
    6·2 answers
  • What percent of the females will have red eyes
    5·1 answer
  • Can somebody do this please
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Please answer this before 2:55 est time .
    12·1 answer
  • What is the name of the common ancestor of the bobcat and the cheetah?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!