1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nata [24]
3 years ago
5

How many chromosomes are in the skin cells of your body

Biology
2 answers:
Crazy boy [7]3 years ago
4 0

Answer:

The answer is 46 chromosomes

Explanation:

In the cells of the body 23 pairs of chromosomes are present. They mean 46 chromosomes in total. In a skin cell of humans, 46 chromosomes are present(human diploid number).

Reil [10]3 years ago
3 0
Here’s your answer. Hope it helps!

You might be interested in
What is a benefit of a nerve plexus? what is a benefit of a nerve plexus? they provide a straight path from the spinal cord to t
adelina 88 [10]
<span>Answer: they provide a straight path from the spinal cord to target muscles.</span>
4 0
3 years ago
1. DEFINE THE TERM ECONOMY​
castortr0y [4]
An economy – householdand is an area of the production, distribution and trade, as well as consumption of goods and services by different agents. Mark as brainliest
7 0
3 years ago
Why do polygenic characteristics have many phenotypes?
chubhunter [2.5K]

Answer:

The involvement of more than two genes.

Explanation:

The polygenic characteristics have many phenotypes because more than two genes governs the phenotype of individual organism. The single gene contains a pair of alleles that codes for two phenotype and two genes will code for 4 phenotype. Thus, more than two genes for example, three genes will have six phenotypes.

The skin color and height are polygenic characterstics in humans.

5 0
4 years ago
How have extinction events changed the system of the earth?
arsen [322]

Answer:

Explanation:The Carnian Pluvial Episode (Late Triassic) was a time of global to a major extinction event and might have been the trigger of the spectacular known delta system by area (1,000,000 km2) in Earth history.

5 0
3 years ago
Chemical Reactions Quick Check
Nana76 [90]

Answer:The reaction yields something I think...‍♀️

Explanation:

8 0
3 years ago
Other questions:
  • Which substances are most commonly used as building blocks in the synthesis(making) of some lipids
    13·2 answers
  • State one possible reason for the increase in the number of breeding pairs of bald eagles in New York State.
    12·1 answer
  • Which of the following do mosses and ferns have in common?
    8·2 answers
  • Proteins may be classified according to their three-dimensional shapes. Determine whether the following examples and description
    5·1 answer
  • When a gene changes with a population over time it is referred to as
    6·1 answer
  • I need help ASAP pls SOLVE THIS PLSS<br> I will give BRAINLIEST
    9·2 answers
  • How is the process of using fossil fuels to produce electricity similar to and different from using nuclear power to produce ele
    8·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • It was my first day in the class. I was very nervous as the college was away from my home town. I had to stay away from my paren
    7·1 answer
  • Question 3 of 10
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!