1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
stira [4]
3 years ago
15

Use the options below to complete each sentence.

Biology
1 answer:
Alex787 [66]3 years ago
8 0

Answer:

no its predation, competition, cooperation

Explanation:

i just did it

You might be interested in
Eating a small serving of a food that is very acidic might present something of a paradox to your stomach because
Reptile [31]
 the presence of food in the stomach typically causes release of gastrin, but low pH inhibits release of gastrin.
6 0
3 years ago
Oi! Bakugo here. I need some help again.
pishuonlain [190]

The decrease in reproductive function.

Explanation:

For a couple attempting to have a child, having at least two miscarriages may be a sign of an chromosomal abnormality.

Hi btw

7 0
3 years ago
Can somebody answer the unsolved ones ?
kherson [118]
There are 15 students in math class.at the begning of class everyone races into class as everyone love maths.the professor takes note of the first 5 students who gets class and ranks them according to the order in which they entred as their top 5 favourite students. in how many different ways could the professor rank their top 5 students using formulla from combinations and permutations
4 0
4 years ago
The wall of the left ventricle is thicker than that of the right and the left ventricle pumps more blood than the right. Are the
Rus_ich [418]

The wall of the left ventricle is thicker than that of the right - True

The left ventricle pumps more blood than the right - False

<u>Explanation:</u>

Heart has 4 number of chambers. One among these chambers is the left ventricle. Among the four cambers of the heart, the thick one is the left ventricle. It appears below the left atrium. The left ventricle is present in the bottom left part of the heart. When the contraction of heart occurs the blood from the valve called mitral enters the left atrium from the left atrium.  

The left ventricle transports the oxygenated blood to the human body. The left ventricle needs along these things for pumping the blood. The right ventricle can function by itself and is more powerful than left ventricle. The right ventricle is responsible in pumping blood to the lungs on its own.

7 0
3 years ago
Animals store most of their excess energy reserves as_____,and this is explained because______.
Tatiana [17]
Fat; they store twice as much energy per gram
7 0
3 years ago
Other questions:
  • What happens when warm air rises? Global temperature decreases. The movement creates a difference in air pressure. Cool air rise
    6·2 answers
  • The information contained within a gene is not directly copied into which of the following chemical forms?
    15·1 answer
  • A persons pancreas begins producing glucagon. What is most likely the stimulant?
    6·2 answers
  • Please help me this is a assignment will give the brainlyest answer  
    12·1 answer
  • Which pregnancy-specific structure is responsible for delivering nutrients and oxygen to the fetus and removing waste products?
    10·1 answer
  • What organism uses carbon dioxide and for what purpose is it used?
    14·2 answers
  • B. How do the roots of the trees may help in controlling soil erosion?
    14·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • In which phase of mitosis do the sister chromatids get pulled apart to opposite ends of the cell?
    12·2 answers
  • Sodium molecules are too large to fit through a cell
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!