Answer:
The chromatids contain the maternal DNA only.
Explanation:
They must contain half the original number of chromosomes. It must contain only one chromosome in place of each homologous pair of chromosomes, so it is endowed with either the maternal or the paternal copy of each gene but not both.
-If you think my answer was helpful, please give me the brainliest answer!
It should be
AGATACCATGGTTACCCGGTTCCA
Answer:
Chloroplasts are found in plant cells only because chloroplasts contain chlorophyll which is essential for photosynthesis. Chlorophyll traps sunlight and uses it to prepare food for plants by the process of photosynthesis.
Answer:
umm i would help but i dont know what this is i'll try
Explanation:
avradge star:white dwarf, nutron star
massive star:super nova, planitary nubla
