1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8090 [49]
3 years ago
13

Three phases of interphase and describe an activity unique to each phase

Biology
1 answer:
hodyreva [135]3 years ago
6 0
G1--- the cell is growing up feeding for 1

S-- the cell starts to repucate the chromosomes

G2--- the cell is growing for 2

You might be interested in
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
What are cumulonimbus clouds?
Mazyrski [523]

Explanation:

Cumulonimbus clouds are a type of cumulus cloud associated with thunder storms and heavy precipitation. They are also a variation of nimbus or precipitation bearing clouds. They are formed beneath 20,000 ft. and are relatively close to the ground. ... These clouds often produce lightning in their heart.

7 0
3 years ago
Magnetic storms are the result of which of the following?
Molodets [167]

Answer:

Answer: The answer is B, an increased number of solar wind particles. and I don't care if I get brainiest

5 0
3 years ago
If the cell body of a pns neuron survives when an axon is damaged, axon filaments can extend peripherally from the injured site
Julli [10]
The statement above is TRUE.
The peripheral extension of an axon filament from an injured site toward an original target is an example of axonal regeneration. Axon regeneration in the matured mammalian central nervous system is very limited after injury. But axonal regeneration is still possible in some instances such as the one given in this question.
8 0
3 years ago
Could the mother or the father (or both be "responsible" for this aneuploid condition in a child? explain your choice
eduard
Nondisjunction is the failure of homologous or sister chromatids to separate properly during cell division .There are 3 forms of non junctions.1)failure of a pair of homologous chromosome to separate in meisis 1
6 0
3 years ago
Other questions:
  • Why is mitosis important to organisms? Check all that apply. reproduction of the organism growth of the organism repair of damag
    11·2 answers
  • What primarely determines the carrying capacity of a population​
    13·2 answers
  • State two principles of treatment of a disease
    7·1 answer
  • What is 1000×1000=??​
    10·1 answer
  • The relationship between a gene and a messenger rna is that ________.
    14·1 answer
  • Will give brainliest to first correct answer.
    10·1 answer
  • HELPPP PLEASE!!!Which of the following is NOT a
    6·1 answer
  • Which of the following are likely topics in a biology course
    7·1 answer
  • Mr. Fuad and Mr. Razak live as neighbours in a village near the sea. Mr. Fuad is a fisherman while Mr. Razak teaches at a school
    6·1 answer
  • Where did the asteroid that killed the dinosaurs land.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!