1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mylen [45]
3 years ago
12

Name three STIs that can be life-threatening or lead to life-threatening illnesses.

Biology
2 answers:
ratelena [41]3 years ago
6 0
There are types of STIs that can be life-threatening or lead to other life-threatening illnesses. These STIs are syphilis, Gonorrhea, human papillomavirus (HPV), hepatitis B, and human immunodeficiency virus (HIV). However, response varies from person to person.
san4es73 [151]3 years ago
6 0
 Gonorrhea, human papillomavirus (HPV), hepatitis B, and human immunodeficiency virus (HIV). However, response varies from person to person.
You might be interested in
Hypothesis: In this section, please include the if/then statement you developed during your lab activity. This statement reflect
Sonja [21]
...carbon dioxide levels will Increase
.... temperatures will Increase
6 0
2 years ago
As a final exam question in your biology course, you are asked to identify an animal that you immediately recognize as a chordat
julia-pushkina [17]

Answer: c) and b) are correct.

The brain is encased in a protective bony or cartilaginous housing in craniates.

The anterior end of the nerve cord is elaborated to form a brain in craniates.

Explanation: The craniates include the chordata with well-defined heads. This includes mammals, reptiles and fishes. So we can discard the other answers. Because most craniates have functional jaws, and the adults do not lose their chordate characteristics. The last one does not apply as a specific feature because the tunicate have neural crest but are not recognized as craniata.

8 0
3 years ago
Read 2 more answers
Oxygen is needed for this process to occur
Vinil7 [7]

Answer:(We breathe because oxygen is needed to burn the fuel [sugars and fatty acids] in our cells to produce energy.) What happens in the process of respiration? ... (The energy station of the cells, called mitochondria, process oxygen to power the cells. As part of the combustion process, carbon dioxide is released.)hope it helped in someway ig idk

Explanation:

6 0
3 years ago
Read 2 more answers
How do the 2 sides of the brain communicate?
8090 [49]

The two (2) sides of the brain are able to communicate through the corpus callosum.

<h3>What is a brain?</h3>

A brain can be defined as an organ of soft-nerve tissue that is found within the skull of vertebrates, and it's mainly responsible for the coordination of nervous activities, sensation and intellect in living organisms.

Based on medical information and records, the two (2) sides of the brain (symmetrical left and right hemispheres) are able to communicate through the corpus callosum.

Read more on brain here: brainly.com/question/1980581

#SPJ12

6 0
2 years ago
Please help me with 9 &amp; 10 I need to pass this test
lana66690 [7]

Answer:

9 th qn answer us 4th option(D)

and 10 th qn answer is 3rd option (C)

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is most likely to be found near a volcano? a. granite c. sandstone b. gypsum d. schist
    6·2 answers
  • Explain this statement: The energy for all the organisms in a food web can be traced back to the Sun.
    13·1 answer
  • Ions are defined as _____.
    5·2 answers
  • 4 characteristics of plants
    8·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • The manufacturer of the chocolate mint cookies changed the ingredients of its cookies. Each serving now has 1 gram of saturated
    14·1 answer
  • Will give brainliest How would this change MOST LIKELY affect the various populations over time?
    5·1 answer
  • Beavers are able to adapt to the changing conditions of all four seasons. Which of the following would threaten the survival of
    5·2 answers
  • What would be the outcome of the processes shown below if the mRNA never moved outside
    12·1 answer
  • A couple, both carriers of cystic fibrosis (CF) alleles, can decrease their odds of having a child with CF by performing an in v
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!