1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harrizon [31]
4 years ago
8

Rudolf Virchow's and Louis Pasteur's work resulted in significant contributions to cell theory but also

Biology
2 answers:
Vladimir [108]4 years ago
6 0

Answer:

In disproving the theory of spontaneous generation

Explanation:

sleet_krkn [62]4 years ago
5 0

contradicted the accepted belief in spontaneous generation

You might be interested in
Monocots and dicots are two groups of _____.
Step2247 [10]
I believe the correct answer is the second option. Monocots and dicots are two groups of angiosperms. This group of plants are seed bearing plants. Flowers are their reproductive system where the ovules are being enclosed in the ovary. Angiosperms can be found in every habitat from grasslands and forests to deserts and sea margins. Angiospersms are divided to monocots and dicots. Monocot plants are characterized by having one cotyledon while dicots have two. Also, leaf veins of monocots are branched while that of dicots are parallel. The root system of monocots is a fibrous root system while dicots have a taproot system.
3 0
3 years ago
Explain why science is a continuous progression of study
Sergio [31]
Well I won't go to tooooooo much of that detail but the thing is FACT BY ME that everything around u is science and when u learn about ur surroundings it is science...!!!!
3 0
3 years ago
An open-minded scientist does all of the following except:
NNADVOKAT [17]
I think it would be D
5 0
3 years ago
Read 2 more answers
Why is understanding the environment of fossilized organisms important to scientific research?
Pepsi [2]

To understand the environment of the fossilized organism to see what it would have ate or drank anything. in the surrounding area.

8 0
4 years ago
why do i exist?A. we don'tB. we are all in a simulationC. when a mommy and a daddy get together....D. long words
Mademuasel [1]
Being realistic, C is the right answer
7 0
3 years ago
Read 2 more answers
Other questions:
  • true or false: the fungi that cause some diseases can spread easily because they produce spores at the site of the infection
    6·1 answer
  • What are two important fuels that comes out of the oil refining process?
    5·1 answer
  • __________ is the mother's side of the placenta.
    7·1 answer
  • Ocean surface currents circulate in clockwise direction in the Southern Hemisphere.
    6·1 answer
  • When a doctor observes your symptoms and tells you that you have flu, she is reasoning?
    14·1 answer
  • How does the cleavage of feldspar differ from the cleavage of mica?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Please help me for 10 points
    8·1 answer
  • How many sister chromatids are there in metaphase
    9·2 answers
  • What are two examples of proteins
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!