1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
3 years ago
14

Question 42 pts Which characteristic could help you distinguish between bacteria and fungi? (2 points) Group of answer choices B

acteria are single-celled organisms but most fungi are not. Only fungi have cell walls, but bacteria do not. Fungi are decomposers but bacteria are not. Fungus only grow in moist locations, bacteria do not
Biology
1 answer:
umka21 [38]3 years ago
7 0
The answer is A. Bacteria are single-celled organisms but most fungi are not.

hope this helps !
You might be interested in
Write an equation perpendicular to the line y=1/4x -9 and passes through (1,1)
Lostsunrise [7]
First you have to change the x value to 4x because for it to be perpendicular it has to be opposite slope so the equation is y=4x-9 

4 0
4 years ago
Read 2 more answers
The example of learning to write shows that with a little help, most people can have their behavior
Kitty [74]

Answer:

Influenced

Explanation:

Based on the question, you can tell that it is either shaped or influenced, but the way this sentence is worded, I'd say influenced because you don't really "shape" your behavior.

3 0
3 years ago
What do scientist use to study pre-Cambrian time?
julia-pushkina [17]

Answer:

Rocks.

Explanation:

Scientists study rocks from the Precambrian period because isn't really a significant fossil record from the Precambrian.

8 0
3 years ago
Read 2 more answers
What does the letter "A" stand? 
aleksley [76]

The letter "A" stands for :

B) Adenine.

Nicotinamide adenine dinucleotide ( NAD ) is a cofactor found in all living cells.

Hope this helps!

Davinia.

6 0
4 years ago
Read 2 more answers
What’s a feature of an organism<br> 1.chromosome<br> 2.cell<br> 3.trait
slamgirl [31]

number 1

Explanation:

numbet 1111111111111111111

6 0
3 years ago
Read 2 more answers
Other questions:
  • Indicate whether the following statements about genetically modified foods are true or false. Genetically modified foods are res
    6·2 answers
  • What can you conclude about the amount of dna that is associated with each nucleosome?
    9·2 answers
  • Key Concept Check Why is Earth warmer at the equator and<br> colder at the poles?
    13·2 answers
  • A location's weather depends on...
    5·2 answers
  • Besides turning enzymes on or off, what other means does a cell use to
    13·1 answer
  • What type of cells are used to seek and destroy pathogens?
    11·1 answer
  • 1. Which of these decreases as we
    8·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Three bird species share a habitat Bird A eats insects and plant seeds. Bird B drinks flower nectar. Bird C eats plant seeds. A
    13·1 answer
  • Which location in the figure shows where opal is most likely to form ?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!