1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Troyanec [42]
3 years ago
6

BRAINLIESTTT ASAP!!!

Biology
1 answer:
harina [27]3 years ago
7 0

Almost positive that it's option C, because ultraviolet rays indeed do that, i'm not good with the study of x-rays but i'm sure it doesn't go with #3.

You might be interested in
What are the factors that allow the aquatic pyramid of biomass to be inverted?
Umnica [9.8K]
Because of the relative longevity and reproductive capacity of predators vs.<span>plankton</span>
7 0
3 years ago
Read 2 more answers
What is the surgical procedure in which a balloon-tipped catheter is inserted into a diseased, narrowed coronary artery and then
Lelu [443]

Answer:

Answer is coronary angioplasty.

Explanation:

The coronary angioplasty is a kind of procedure that involves the insertion a balloon- filled catheter into the blood vessel for the purpose of increasing blood flow.

Medical imaging is use in guiding the catheter to the targeted site. And the use of a metal mash tube known as stent may be adopted or not.

The coronary blockage prevent the flow of blood to the heart.

Note that, this procedure is considered to be better in some aspects to coronary artery bypass grafting [CABG].

This is because. it is not a surgery like CABG,, has fewer risks and a small cut.

8 0
3 years ago
During which step of mitosis do the chromatids line up in the middle of the cell? A. prophase B. telophase C. anaphase D. metaph
d1i1m1o1n [39]

the answer is A prophase


7 0
3 years ago
Yall i need helpp asappp plss​
Amiraneli [1.4K]

Answer: The acceleration of that object

Explanation:

6 0
3 years ago
Write the chemical formula for each of the following compounds. Start the formula with the first element listed in each statemen
Anika [276]

Answer:

C3H8O= C3 + H8 + O

Explanation:

You do not need to write the one for oxygen, yo can if desired

7 0
3 years ago
Other questions:
  • Which of the statements describes Neanderthals?
    6·1 answer
  • Why, Tommy, oh why? Your ever-returning patient has fractured his femur really badly. This is going to be a lot of work. Can you
    13·2 answers
  • Don recorded his food intake for a week and then used a computerized dietary analysis program to analyze his diet record. accord
    15·1 answer
  • Are the chloroplasts uniformly distributes or near the edge of the cell in tap water?
    11·1 answer
  • The network of canals within the cytoplasm where proteins are manufactured for use in the cell is a(n):
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How do villi help the lymphatic system?
    10·2 answers
  • Why do multicellular organisms generally live longer than un<br> organisms?
    12·1 answer
  • A flashlight uses four batteries to power it. Which type of current flows inside the flashlight? A. direct B. alternating C. rep
    9·2 answers
  • What food does a artic animal eat?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!