Answer:
Hope it helps and HAPPY NEW YEAR MY DEAR ☆☆
Explanation:
Box #1: Black fur, black eyes
Box #2: Black fur, red eyes
Box #3: White fur, black eyes
Box #4: Black fur, red eyes
Answer:
Yes,homeostasis inside a cell organelle .
Its function is to maintain a normal balance within the body regarding its temperature, salt concentration and food instake.
Explanation:
Hope this will help yuh!
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
Thalidomide may be defined as a type of the sedative drug that in the earlier time referred for the pregnant ladies. This drug causes the world wide tragedy and acts as a teratogen.
This drug causes mutation in the fetus. The Ames test is effective to understand the mutagenicity of the drug. In this test, if the auxotrophic strain of the bacteria is grown on the the deficient media containing thalidomide drug. The bacteria growth indicates the positive Ames test and the substance is considered as mutagen.
