1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frutty [35]
3 years ago
8

A protein is a polymer consisting of a specific sequence of

Biology
2 answers:
Svet_ta [14]3 years ago
6 0
Amino acids
(This is also known as the primary structure and determines what proteins are coded for)
valentina_108 [34]3 years ago
3 0

Answer:

amino acids

Explanation:

one of the bases or examples of proteins

You might be interested in
Without a cuticle, a plant _____.
kolbaska11 [484]
The answer is A. The cuticle is a protective film that is non cellular covering the outer cell layer (epidermis) of green, aerial parts of plants. Cuticles protect plants against drying (desiccation), UV radiation, and various kinds of physical, chemical and (micro)biological agents. The cuticle also provides some support. Actually the cuticle which protects the underlying tissues has basically the same function as our own skin. In several groups of plants, cuticles are very resistant. Only few groups do not generally have highly resistant cuticles e.g. ferns and lycopods.
6 0
3 years ago
Read 2 more answers
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Hagfish are noted for having a skull, but no . . . A. pharyngeal slits.
Tpy6a [65]

Answer:

but no the answer is spine which can also be called vertebral column so is B

7 0
2 years ago
Read 2 more answers
For which amino acid is AAA a codon
abruzzese [7]

Answer:

proline

Explanation:

coded for the polypeptide poly-proline. Therefore, the codon AAA specified the amino acid lysine, and the codon CCC specified the amino acid proline.

7 0
2 years ago
An
lorasvet [3.4K]
Amplitude of wave is A
7 0
2 years ago
Read 2 more answers
Other questions:
  • Part A Nitrifying bacteria convert _____ to _____. Nitrifying bacteria convert _____ to _____. nitrogen gas ... ammonium nitroge
    15·1 answer
  • LINNAEUS classified organisms into two kingdoms. How was his system of classificationImpacted after the invention of the microsc
    9·2 answers
  • If our visual perception depends only on the feature detectors in the visual cortex, what would we see?
    8·1 answer
  • The countercurrent multiplier is a system by which the:______.
    6·1 answer
  • Nitrogen is released to the abiotic parts of the biosphere from the process of ___and___
    7·1 answer
  • Why is it important for cells of multicellular organisms to undergo mitosis
    11·2 answers
  • Which of the following is an example of a plant virus?
    7·1 answer
  • this project, you will analyze claims about the causes of inherited genetic variation. You will then make your own claim based o
    14·1 answer
  • 3. What biotic and abiotic factors
    14·2 answers
  • This diagram shows a chemical reaction in which two glucose molecules combine to form a molecule of maltose.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!