1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
serious [3.7K]
3 years ago
5

What disease did the Native Americans transfer to the Europeans?

Biology
2 answers:
katovenus [111]3 years ago
6 0
It’s believed that one Native American disease did slip on to the European ships and sailed onward to Europe doing some major damage in the process. That disease was syphilis.
oee [108]3 years ago
3 0

Answer:

Influenza, smallpox, measles, and typhus fever

Explanation: I hope you like my answer. Thank you

You might be interested in
The diagram below represents some stages in the life cycle of humans. The numbers in the diagram represent various processes in
ddd [48]

Answer:

The diagram below represents some stages in the life cycle of humans. The numbers in the diagram represent various processes in the cycle.

4 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Will jaws of life damage the environment​
Lesechka [4]

Answer:

No

Explanation:

This tool does not effect the environment because it doesn't contain any harmful chemicals that would interfere with the environment's well being.

3 0
3 years ago
Read 2 more answers
How can some organisms survive as single cells when other organisms require many cells?
irakobra [83]

Well, different organisms require different things. A single celled bacteria does not need a lot at all compared to a plant or animal. One cell can support a bacrerium. An animal needs many cells to carry out the functions necessary for it to live.

Happy to help! Please mark me the Brainliest!

6 0
3 years ago
Why are there no carriers with dominant pedigrees?
elena-14-01-66 [18.8K]
You can't have a carrier with a dominant pedigree because other wise than individual or organism would be afflicted by the gene and render them incapable of being a carrier. A carrier is an individual/organism that has a normal phenotype (meaning it is not afflicted by said gene) but is carrying the gene that could cause disease or whatever the affect may be. In this case the gene would have to be homozygous recessive to be expressed. Hopefully this helps! 
7 0
3 years ago
Read 2 more answers
Other questions:
  • If your blood becomes too diluted, what will happen to the red blood cells?
    14·1 answer
  • Scientists have determined that the high nitrate levels in local groundwater supplies are due to the use of soil fertilizers in
    8·1 answer
  • The ability of the human body to break down the red color in beets is controlled by an autosomal dominant allele. The inability
    15·1 answer
  • I student conducts an experiment to see how music affect plant growth the obtained for identical plants each one is potted in th
    9·2 answers
  • What makes the Sun appear so large and bright as seen from Earth? A) its size B) its heat C) its color D) its location
    15·2 answers
  • Which of the airway do not contain rings of cartilage and are therefore more likely to collapse?
    13·2 answers
  • _____ is the principle whereby improvement occurs when increased demands are made upon the body.
    5·2 answers
  • Crossing over is a process which contributes to diversity in offspring of an organism. Which statement
    6·2 answers
  • Female : XX ::<br> female : eggs<br><br> male : XY<br><br> male : YY<br><br> female : gametes
    8·1 answer
  • Select all the choices that served as early evidence for tectonic plates.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!