Answer:
The diagram below represents some stages in the life cycle of humans. The numbers in the diagram represent various processes in the cycle.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
No
Explanation:
This tool does not effect the environment because it doesn't contain any harmful chemicals that would interfere with the environment's well being.
Well, different organisms require different things. A single celled bacteria does not need a lot at all compared to a plant or animal. One cell can support a bacrerium. An animal needs many cells to carry out the functions necessary for it to live.
Happy to help! Please mark me the Brainliest!
You can't have a carrier with a dominant pedigree because other wise than individual or organism would be afflicted by the gene and render them incapable of being a carrier. A carrier is an individual/organism that has a normal phenotype (meaning it is not afflicted by said gene) but is carrying the gene that could cause disease or whatever the affect may be. In this case the gene would have to be homozygous recessive to be expressed. Hopefully this helps!