1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nika2105 [10]
3 years ago
6

Which of the following is considered a bronchodilator?

Biology
1 answer:
shepuryov [24]3 years ago
7 0
Epinephrine HCL is considered as bronchodilator.
You might be interested in
What is true of mutualistic relationships among organisms?
Nat2105 [25]

Explanation:

Mutualism is defined as an interaction between individuals of different species that results in positive (beneficial) effects on per capita reproduction and/or survival of the interacting populations.

3 0
3 years ago
Plz help I need it ASAP
timurjin [86]

Answer:

D

Explanation:

5 0
3 years ago
Read 2 more answers
Cells can interact with other cells?
Allisa [31]

Answer:

Yes. Cells have 'cell receptors' that are used to receive messengers like hormones to communicate. Cell receptors have specific shapes that fit the shape of the messenger that they want to receive. Organs like the pancreas send our these messengers to the cells to order them to do different functions.

3 0
3 years ago
A woman has her personal genome analyzed for the BRCA1 mutation after learning that her father is heterozygous and carries one m
puteri [66]

Answer:

a. 50%

Explanation:

<em>BRCA1 genes is a tumor supressor gene whose harmful mutation can cause hereditary breast ovarian cancer syndrome in both males and females. The BRCA actually stands for breast cancer.</em>

<em>Mutation in BRCA1 gene is heritable and every progeny of a carrier parent irrespective of the sex has a 50% chance of inheriting the trait from such parent, be it from the mother or the father.</em>

Hence, the correct option is a.

5 0
3 years ago
Disease or sickness is caused by microorganisms that grow rapidly between 41 and 140 degrees Fahrenheit. True or False
alisha [4.7K]

Answer:

It is True

Explanation

They thrive at temperatures  in the 41 to 140 degrees.

7 0
3 years ago
Other questions:
  • which organic compounds would be the best to analyze in order to determine if two species are closely related?
    7·1 answer
  • A nurse is assisting a patient with ambulation. the patient becomes short of breath and begins to complain of sharp chest pain.
    6·1 answer
  • A) explain the hardy-weinberg principle of equilibrium theory. (4 pts.)
    13·1 answer
  • What is the answer, help me!
    10·1 answer
  • Consider two pairs of grandparents. The first pair has 4 grandchildren and the second pair has 32 grandchildren. Which of the tw
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • SOMEONE HELP MEEEEEEE PLEASE ILL GIVE 50 POINTS AND BRAINLIEST,
    5·2 answers
  • When plants are closer to sunlight photosynthesis occurs
    12·1 answer
  • Temperatures on Mars reach as high as 20 °C and fall as low as –140 °C. That temperature is colder than anyplace on Earth. Tempe
    5·2 answers
  • 14. Which of the following is an example of
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!