1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Readme [11.4K]
3 years ago
6

A set of characteristics that defines individuals as boys and men or girls and women is called __________.

Biology
1 answer:
Andreas93 [3]3 years ago
7 0
A set of characteristics that defines individuals as boys and men or girls and women is called gender. Nowadays, the issue of gender is a very touchy subject, as it is unknown whether sex and gender are interchangeable anymore, the way they used to be.
You might be interested in
Which of the following is transmitted by Aedes mosquitoes?A. yellow feverB. both dengue fever and yellow feverC. malariaD. dengu
kotegsom [21]

Answer:D) dengue fever, yellow fever, and malaria

6 0
3 years ago
AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
nydimaria [60]

I don see the question if there is one can you explain and ill edit my answer to best fit

8 0
3 years ago
Water functions as a great _________________
nikitadnepr [17]

Answer:

Transporter..it transports substances in plants and animal cells

Explanation:

4 0
3 years ago
Why is homeostasis important for survival
ExtremeBDS [4]
Homeostasis is maintaining an equilibrium or balance. Human bodies only function under very specific conditions, so it is important to maintain them through homeostasis. Otherwise, the proper conditions to function will be missing and we won't be able to function at all.
8 0
3 years ago
Is glucose reduced in the Krebs cycle?
kiruha [24]

Answer:

Thus, during the Citric Acid cycle, the breakdown of glucose into carbon dioxide is completed. There are four redox reactions, three of which yield reduced NADH and one FADH2. Thus, the oxidation of glucose is completed in the Kreb's cycle

8 0
3 years ago
Read 2 more answers
Other questions:
  • How are natural selection, adaptation, and fitness all interrelated?
    8·1 answer
  • The thickest part of the crust occurs in _____.
    12·2 answers
  • Help!!!!!!!!!!!!!!!!!!!
    7·1 answer
  • Which of the following is the correct increasing order of chromosome organization?
    6·1 answer
  • Both a grizzly bear and a slime mold are made of one or more cells that contain a nucleus and other organelles. What can you con
    14·2 answers
  • An arthropod's exoskeleton performs all of the following functions except
    10·2 answers
  • The amount of Earth covered by water might imply that all water is a renewable resource. Which statement best explains why not a
    9·2 answers
  • Which organelle packages proteins into vesicles? *
    8·1 answer
  • How animals protect their young ones?
    7·1 answer
  • write two paragraphs about the qoblin shark and make a goblin shark food web (if you answer this i will give an extra 100 pts
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!