1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
riadik2000 [5.3K]
3 years ago
12

Prior to each cell division, the DNA must replicate. If one strand of DNA has the base sequence, ATCGCC, the complementary (matc

hing) side will be
Biology
1 answer:
marin [14]3 years ago
4 0
The matching stand of DNA is: TAGCGG
You might be interested in
What type of tree flourishes in dry sand and salt water
defon
I thinks its cocoa nut trees 
do you watch Beyond 
My group is helping hands lol

5 0
3 years ago
Read 2 more answers
explain how different processes such as erosion, weathering, deposition and tectonic plate movement cause small and big changes
zepelin [54]

Answer:

they can be big and small erosion take years when tectonic plates move slow but can cause an earthquack so it is the just the way you look at it

Explanation:

3 0
3 years ago
What's a cone of depression?
Dafna1 [17]
What's a cone of depression?

O C. An area where the water table
slopes toward a well
6 0
3 years ago
Describe the components in the blood that affect viscosity
Alborosie

Answer:

components in blood that affect viscosity is formed elements, plasma proteins, WBCs, RBCs and platelets. ... When there is an increase in viscosity, it decreases the blood flow rate, 3. Describe the graph of flow versus viscosity.

5 0
3 years ago
What are three clues of physical change
Talja [164]
If it help u plz pick as best tnx :)<span>1- colour   2- state    3-smell</span>
7 0
4 years ago
Other questions:
  • Give reasons for the following
    12·1 answer
  • In the brain, the ____________ receives signals of increased blood ____________ (concentration) from various receptors. It respo
    10·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Match the following terms to their definitions.
    15·1 answer
  • I need answers to this worksheet!
    10·1 answer
  • The cell membrane A.converts glucose to other energy molecules B.controls which substances enter and exit the cell. C.alters and
    5·1 answer
  • Explain in your own words how some cells know to be muscle and some know to be bone.
    13·1 answer
  • Which of the following sets is an infinite set?
    6·2 answers
  • A nucleotide of dna may contain?
    14·2 answers
  • The largest source of available freshwater on Earth is _____. lakes rivers aquifers ice caps
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!