Answer: Primary and secondary succession
Explanation: In primary succession, newly exposed or newly formed rock is colonized by living things for the first time. In secondary succession, an area previously occupied by living things is disturbed—disrupted—then recolonized following the disturbance.
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
Qualitative: moister, taller, and darker shade.
Quantitative: 0.25-0.5 cm taller, how many cupcakes she could make.
Explanation:
Qualitative is observation based and Quantitative is mathematical based (i.e. measuring, etc.)
Answer:
B)
The exterior of the cell has a net positive charge and the interior has a net negative charge.
Explanation: