1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nimfa-mama [501]
4 years ago
10

Which mineral will NOT scratch quartz? A. talc B. topaz C. diamond D. corundum

Biology
1 answer:
gavmur [86]4 years ago
8 0
The answer to this is B. Topaz
You might be interested in
A chef fills a 40 mL container with 30 g of cooking oil. What is the density of the oil?
Nonamiya [84]

Answer:

So 1 ml=1 cm^3, so 40ml is 40 cm^3

D= m/v

density = 30/40

Density of oil is 0.75 g/cm^3 (which is verified as oil is less dense than water hence floats on it)

Explanation:

8 0
3 years ago
Do you think osmosis occurs when a cell is in an isotonic solution explain your reasoning
Bumek [7]
The word isotonic is used to refer to the solutions (two solutions) which have the same osmotic pressure in both sides of the semipermiable membrane. The condition allows the free movement of water across the membrane. However, this does not change the concentration of the solution across the membrane. 

Hence, osmosis may not occur in this condition. 
3 0
3 years ago
What types of sensors are present within the muscle to identify how much force is generated?
xxTIMURxx [149]

The proprioceptors

The proprioceptors such as muscle spindle and golgi tendon organ are sensors located in the limbs. The proprioceptors give information about muscle length, muscle tension and joint angle which is coordinated to provide information about the limb’s position in space.







3 0
4 years ago
Read 2 more answers
20 POINTS
erastova [34]

Answer:

The clear water representing blood, which runs through the

plastic tubes, will become green as particles from the cardboard tube

are absorbed.

Explanation:

the bold letters are answers

8 0
3 years ago
What is the name for the "in between"phase in cell divisions
Veseljchak [2.6K]

The name for the "In between" phase in cell divisions is interphase. Hope this helps! :)

4 0
3 years ago
Other questions:
  • Why do the gas giants have many moons?​
    14·1 answer
  • During cellular respiration, cells convert oxygen and glucose into carbon dioxide, water, and energy. how is this process relate
    10·2 answers
  • Why you do sometimes shiver when you're cold?
    15·1 answer
  • Match each phylum or class to its correct characteristic.
    6·1 answer
  • People living in and around the Amazon rain forest
    8·1 answer
  • Most freshwater Hydrozoa exist only as ______.
    12·1 answer
  • PROJECT: ECOLOGY Assignment Directions: Basics of Ecology Design and create a "Basics of Ecology" poster or multimedia presentat
    6·1 answer
  • Helpppppp pleasseeee ​
    12·1 answer
  • What is one major difference between viruses and bacteria?
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!