1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
VARVARA [1.3K]
3 years ago
5

What are the walls of a ureter composed of?

Biology
1 answer:
AfilCa [17]3 years ago
4 0

Answer:

C. mucous membrane, smooth muscle, and fibrous connective tissue.

Explanation:

The tube that connects the kidney to the urinary bladder is known as the ureter, it carries urine and is located in the abdomen (upper half) and the pelvic area (lower half).

Its wall has three layers:

  • Outer layer: known as the fibrous coat, is made of fibrous connective tissue.
  • Middle layer: is made of smooth muscle, therefore is known as the muscular coat
  • The inner layer: known as the mucosa, is made of transitional epithelium and it secretes mucus.

Considering this information we can conclude that the correct answer is C. mucous membrane, smooth muscle, and fibrous connective tissue.

I hope you find this information useful and interesting! Good luck!

You might be interested in
When a motor neuron and the skeletal muscle cell it innervates are at rest:?
Nuetrik [128]

<span>Particularly the skeletal muscles at rest gain most of their energy from the aerobic respiration of fatty acids. Hence fatty acids provide the majority of the energy for muscle metabolism when a person is exercising at 25% of VO2max. However, the motor neuron is at rest when a neuron is not receiving any input there will be a potential difference. Thus, the potential difference measured when the neuron is inactive and it is caled the resting membrane potential. </span>

3 0
3 years ago
6. The thin delicate membrane just attached to the cytoplasm is: [MOE 2061] (a) Ectoplasm (b) Endoplasm (c) Tonoplast (d) Protop
Westkost [7]

Answer:

cell membrane

Explanation:

4 0
3 years ago
Look at the three bottles. What evidence is there that a chemical reaction took place?
gregori [183]

Answer:

color changed.

and the temperature changed.

Explanation:

8 0
2 years ago
Which of the following are behavioral adaptions for animals to survive in the extreme cold of the tundra biome?
svp [43]

Answer:

Although habitats provide food, water and shelter that animals need, there is more to survival than just the habitat.

8 0
2 years ago
Read 2 more answers
Erythrocytes live for a maximum of.......days whereas platelets live for ....... days
Tomtit [17]

Answer:

120 \:  days;10  \: days.

Explanation:

Thanks!!!!!

5 0
2 years ago
Other questions:
  • I really need help ASAP!
    11·1 answer
  • Who came up with the continental drift theory? What does it state? <br> fast fast
    9·1 answer
  • This is a real question from my science teacher,
    12·2 answers
  • Someone help me please
    7·1 answer
  • With the global population constantly increasing, at some point food will become limited. What is a way that should NOT be used
    7·1 answer
  • The Hardy-Weinberg principle states that evolution will not occur in a population when environmental conditions are stable. When
    12·1 answer
  • How would you classify the relationship of a hawk and a field mouse in an ecosystem? A) Commensalism B) Mutualism C) Symbolism D
    11·2 answers
  • What two macromolecules make up the cell membrane?
    5·1 answer
  • According to the phenotypic characters of pneumococcus considered in Griffith's
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!