1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
butalik [34]
3 years ago
12

The Earth's changing distance from the Sun during the year causes the seasons true or false​

Biology
1 answer:
Alex3 years ago
7 0

Answer:

False

Explanation:

Even though the idea is logical, Earth's seasons are actually caused by the tilt of earth,earth rotating on it's axis, and Earth's revolution around the sun

hope this helps!

You might be interested in
What is the most common toad of Central America.
kipiarov [429]
Hello!

I believe the answer is the Gulf Coast toad.

Hope this helps! ☺♥
5 0
3 years ago
Which can cause wilting in plants?
ASHA 777 [7]
D. lack of water because plant need water to survive
3 0
3 years ago
Read 2 more answers
What three polysaccharides play a structural role in organisms?
Colt1911 [192]
Chitin - part of insects hard body and part of fungus
Cellulose - part of plant cell walls
Pectin - also part of plant cell walls
3 0
3 years ago
In which part of the body would you find striated muscle tissue with relatively small cells that have one or two nuclei?
Ilya [14]

Answer: Heart

The striated muscle tissue with relatively small cells that have one or two nuclei can be found at the heart. The intracellular calcium signaling is an intrinsic component of signal transduction pathways that regulate vital aspects of muscle function including excitability, force production, protein synthesis, and energy expenditure that occurs in the striated muscle tissue of the heart. 

3 0
3 years ago
Read 2 more answers
Which subunit of the E. coli polymerase confers specificity to transcription?
WITCHER [35]
Ïf is your answer your welcome
7 0
3 years ago
Other questions:
  • What element makes up most of the earth's core?
    5·1 answer
  • Which of the following best describes philosophy?
    11·1 answer
  • Which weighs more: a pound of feathers or a pound of lead? Explain.
    8·1 answer
  • PLEASE HELP QUICK! Number the organisms from 1 (most abundant) to 8 (least abundant)
    13·1 answer
  • When conditions in the environment change, a lack of genetic diversity may be disadvantageous for organisms that reproduce _____
    14·1 answer
  • ___1. The stage during which the chromosomes are replicated / copied is
    7·1 answer
  • Help meeeeeeeeeeeeeeeee my friend needs it
    5·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • Can someone please help me i don’t know the answer
    8·2 answers
  • the efficiency of aerobic metabolism is greater than that of anaerobic metabolism even though much more energy is released in ae
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!