1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashutka [201]
3 years ago
6

A collection of stars, dust, and gas bound together by gravity is... a. universe b. solar system c. planet d. galaxy explain why

for every answer PLEASE I NEED THIS NOW IT IS DUE TODAY!!!!!!!!!!!!!
Biology
1 answer:
WINSTONCH [101]3 years ago
5 0
The answer is galaxy. something that works wonders is quizlet
You might be interested in
Please answer this, ITS IMPORTANT AND I NEED ASAP!!!
Neko [114]

Answer:

Chromosomes contain genes, which help to determine an organism's traits. Genes come in alternate forms called alleles. The actual gene combination that an organism receives from its parents is called its genotype, while the trait that gets expressed as a result is referred to as its phenotype. If an offspring receives the same type of allele for a given gene from each parent, it is said to be h o m o z y g o u s. If the alleles differ, it is h e t e r o z y g o u s.

Explanation:

5 0
3 years ago
What are two global issues associated with using fossil fuels for energy?(1 point)
astraxan [27]

Answer: b. fossil fuels are nonrenewable, so humans will run out of them eventually. burning fossil fuels also contributes to global climate change by releasing carbon dioxide into the atmosphere.

Explanation:

Fossil fuels are limited and we will run out of them eventually. They cannot be replenished in a single human's lifespan. Fossil fuels contribute to the destruction of ecosystems, but not only that. They release carbon dioxide into the atmosphere that warms the Earth. Therefore, anything other than B. would be incorrect.

4 0
2 years ago
Read 2 more answers
Match the following terms and definitions. 1. cross-breeding; a method that unionizes gametes of differing genes to create a new
Alexus [3.1K]
<h2>Answer </h2>
  • Hybridization
  • Recombinant DNA
  • Selective Breeding

<u>Explanation</u>

1. Cross-breeding; a method that unionizes gametes of differing genes to create a new individual is hybridization. It is the idea of combining atomic orbitals into different hybrid orbitals that is proper for the pairing of electrons to create chemical bonds in valence bond as per the atomic theory.

2. Cultured DNA molecules from different biological sources is recombinant DNA. They are the molecules are DNA molecules determining by laboratory techniques of genetic recombination to take mutually genetic material from various origins.

3. A process of breeding organisms because of their specific traits is selective breeding. It is the method that grants humans practice animal breeding and plant breeding to selectively develop selective over phenotypic traits

8 0
3 years ago
True or false if false type the right answer. History<br>Sorry I choosed biology by mistake
bogdanovich [222]

Answer:

the first is mostly false but somewhat tru the second is true and the third is true

Explanation:

7 0
2 years ago
Alligators life cycle compared to a human
Levart [38]

Answer:

Alligators: Growth depends greatly on the surrounding environment, including temperature, and sexual maturity is reached at approximately 6 feet long. The life span varies greatly for these large reptiles, averaging 35 to 50 years for wild alligators and 60 to 70 years for crocodiles.

Humans:In summary, the human life cycle has six main stages: foetus, baby, child, adolescent, adult and elderly. Although we describe the human life cycle in stages, people continually and gradually change from day to day throughout all of these stages.

4 0
2 years ago
Other questions:
  • In 2005 the Northwestern University women's lacrosse team won an NCAA championship and was invited to the White House to receive
    5·1 answer
  • Which statement best describes the relationship between photosynthesis and cellular respiration?
    11·2 answers
  • Anyone have this answer
    14·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Help due today <br> Biology
    10·1 answer
  • Which term describes the tendency of an organism to regulate internal conditions for maintaining good health?
    7·2 answers
  • What general name is given to tracts that connect the right and left cerebral hemispheres?
    8·1 answer
  • What is the unit of lungs?<br><br>설명해주세요 !! ☂​
    11·2 answers
  • Which of the following would cause mountains to wear down to become more like hills over time?(1 point) Erosion that carries sma
    7·2 answers
  • How does hybridization and artificial/selective breeding differ from GMOs?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!