1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
12

Which factors can have the greatest effect on the health of a river

Biology
1 answer:
Tomtit [17]3 years ago
5 0
It’s the letter C.................
You might be interested in
The level of productivity in oceans can be explained by the fact that ____.
musickatia [10]

The level of productivity in oceans can be explained by the fact that the volume of the global ocean is enormous.

The oceans cover about 70% of the earth. This makes the ocean to occupy the largest volume on earth.

In spite of this large volume, the productivity of the ocean is just about 55 billion tons.

This low productivity of the ocean is tied to its large volume and small amount of primary productivity.

Learn more: brainly.com/question/22283115

8 0
2 years ago
What happens a few days after fertilization
olga2289 [7]
Fertilization is the impregnation, the state when<span> a sperm cell penetrates the egg cell and the genetic material of both cells combines.
A few days after fertilization i</span><span>mplantation happens. Implantation is the attachment of the fertilized egg to the uterus, happens on average about 9 days after ovulation/fertilization (between 6 and 12 days)  and is required for the fetus to continue to grow.</span>
3 0
3 years ago
Read 2 more answers
What part of the fibula is found near the knee joint?
kkurt [141]
The part of the fibula that is found near the Knee joint is the head
6 0
2 years ago
What two things are found in the nucleus of a eukaryotic cell?
elixir [45]
The mitochondria and chloroplasts are found in the nucleus 
5 0
3 years ago
Read 2 more answers
The Atlantic Ocean
pentagon [3]
Atlantic ocean is a Plate boundaries
7 0
3 years ago
Other questions:
  • Use the numbers 1, 2, 3, 4, and 5 to place the protein creation steps below in the correct order. Ribosome attaches to the mRNA.
    9·2 answers
  • Difference between morphological and physiological variation
    6·1 answer
  • The cell membrane of a red blood cell will allow water, oxygen, carbon dioxide, and glucose to pass through. Since other substan
    6·2 answers
  • It's good to give ...... food to your body.
    15·1 answer
  • The circulatory system is directly responsible for which of the following
    8·1 answer
  • Which of the following statements are TRUE? 1-Electron carriers are located at ribosomes. 2-ATP is a common intermediate between
    11·1 answer
  • BIOLOGY!!! HELP PLSSSS. 2,3 &amp; 5
    14·1 answer
  • How does a virus keep the body from creating antibodies?
    15·1 answer
  • What are the economic activities in the Amazon forest
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!