Answer:
1.126 x 10^22
Explanation:
pV = nRT
7.53 x 10 = n x 8.31 x 485
n = (7.53 x 10) / (8.31 x 485) = 0.0187 moles
M = n x Avogadros number
0.0187 x 6.02 x 10^23 = 1.126 x 10^22
Molar mass HNO₃ = 63.0 g/mol
number of moles = 3.94 / 63.0 => 0.0625 moles
Volume = moles / molarity
V = 0.0625 / 1.50
V = 0.04166 L x 1000 = 41.66 mL
hope this helps!
Explanation:
Translation is the process by which a polypeptide is polymerized from genetic information.
Firstly we have to make a transcription from the coding DNA strand to a single RNA strand (mRNA). RNA pol reads from 5' to 3' of the template strand and nucleotides are added by complementarity ( Adenine with Uracil, Thymine with Adenine and Cytosine with Guanine, Guanine with Cytosine).
DNA: 5'- CGTTATGTGGACTCTCTGGTATGACTCACCTTAT -3'
mRNA: 5'-GCAAUACACCUGAGAGACCAUACUGAGUGGAAUA -3'
mRNA goes to the ribosomes where translation takes place. The enzyme will read every three letters (codon) starting at the start codon sequence (TAC in DNA, AUG in mRNA). According to codons tRNA carrying the amino acids will place it (by complementary to their anticodon) and the enzyme will join it to the nascent polypeptide or protein.
In order to do this we need to look up the genetic code and assign the proper amino acids.
Unfortunately the given strand does not have a start codon TAC codifying for initial methionine.
A force or a type of friction?
Force: Resistance--> If you go swimming, you feel the water pushing against you, making it harder to walk in water and even to swim unless you are doggy pattling or front strokes. Resistance is a force going against a solid object.
Friction: Fluid friction which is friction that occurs after a solid object travels through a liquid or gas
Na₂S(aq) + Cd(NO₃)₂(aq) = CdS(s) + 2NaNO₃(aq)
v=25.00 mL
c=0.0100 mmol/mL
M(Na₂S)=78.046 mg/mmol
n(Na₂S)=n{Cd(NO₃)₂}=cv
m(Na₂S)=M(Na₂S)n(Na₂S)=M(Na₂S)cv
m(Na₂S)=78.046*0.0100*25.00≈19.5 mg