1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
const2013 [10]
3 years ago
9

What inherent characteristics of populations did both Darwin and Wallace propose were need for natural selection to lead to adap

tation?
Biology
2 answers:
Elena L [17]3 years ago
7 0

Answer:

An individual cannot develop traits that make them adapted to a distinct environment. The manner by which a population becomes more adjustable with an environment is when the individuals within the population exhibit traits, which are favorable to the specific environment. This, in turn, offers them a higher rate of survival.  

Some of the inherent features of a population, which both Wallace and Darwin proposed as the need for natural selection that eventually results in adaptation are:  

1. The population needs to exhibit variability within the traits.  

2. Organisms generally over-reproduce leading to competition for resources between the offspring.  

3. Some of the individuals in a population are more successful at reproduction.  

tigry1 [53]3 years ago
6 0

Answer:

Darwin and Wallace both the naturalist known for the theory of natural selection. These naturalist have proposed various inherent characteristics that are essential for natural selection process to result in the change or adaption according the atmosphere.

The inherent characteristic is that the population must have variability as trait, increasing the competition by over reproduction and in a population some individuals are successful at reproduction.

Thus, the correct answer is mention above.

You might be interested in
What is a natural depression filled with standing freshwater called please help
nydimaria [60]

Answer:

it was b!!!!!!!! i took the test

7 0
2 years ago
Fatigue that occurs in response to extended submaximal exertion is usually due to ________ whereas fatigue to a short duration o
e-lub [12.9K]
Glycogen depletion, elevated inorganic
8 0
3 years ago
Identify the two minerals shown that exhibit fracture as a dominant form of breakage
bazaltina [42]
Two minerals that exhibit fracture as a dominate form of breakage are quartz and olivine. <span />
4 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Who were the first guys to build a model of a DNA structure? (Thank you :). )
Keith_Richards [23]

Answer:

James Watson and Francis Crick were mainly the first to build a model of a DNA structure. (Your welcome).

Explanation:

3 0
3 years ago
Other questions:
  • Which most direct controls the rate at which food is broken down to release energy
    14·1 answer
  • A baby is assessed at one minute after birth according to the apgar scale. three of the five vital signs are good, but the baby
    13·1 answer
  • In mammals, mature red blood cells do not have mitochondria. Instead of using oxygen to help produce ATP, they use a form of ana
    13·1 answer
  • Which of the following statements about the Earth's atmosphere is true? It contains 21% oxygen. It contains 78% water vapor. It
    15·1 answer
  • Which of the following are methods of classical biotechnology
    11·2 answers
  • How many years does it take for the sun to pass the earth
    9·1 answer
  • The table below shows carbon dioxide emissions and world population data for several years between 1800 and 2004.
    7·1 answer
  • What are two examples of decomposers that break down animal skin?
    9·1 answer
  • Plz answer it’s due today
    10·1 answer
  • Indicater I need the meaning
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!