1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alisha [4.7K]
3 years ago
13

What did Enlightenment thinkers believe predated society and was superior to the laws of the church or the state?

Mathematics
1 answer:
lubasha [3.4K]3 years ago
8 0
I think it is D but not for sure
You might be interested in
What is 3/4 -7/10 -3/4 and 8/10 In order from least to greatest
zaharov [31]
-3/4, -7/10, 3/4, 8/10 is least to greatest
3 0
3 years ago
Read 2 more answers
An eight - sided polygon is a(n)
Ludmilka [50]
Its called a octagon, hope that helps
7 0
4 years ago
Read 2 more answers
A family buys 4 airline tickets online. The family buys travel insurance that costs ​$19 per ticket. The total cost is ​$752. Le
kumpel [21]
(x•19)4=752

x would be multiplied by 19 then after it’s getting multiplied by 4.
3 0
3 years ago
Can someone show me the graph and domain and range for this piece wise function?
Alex
So we look at the conditions if x<1 and if x≥1 x<1 means x is less than 1 x≥1 means x is greater than 1 including 1 that includes all real numbers so domain is all real numbers range is (sart with top and go up, if x=1 then f(1)=7 so from 7 to infinity, then other one, x<1, -inifinity to 4 not including 4 so the range with interval notation is (-∞,4) U [7,∞) graph is the graph of each, but pt together (see attachmetn)

8 0
3 years ago
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
3 years ago
Other questions:
  • -11 and 1/6 as a decimal
    11·1 answer
  • What is the answer to 3^=55
    5·1 answer
  • Can someone please help I'm trying to get my grade up but I'm struggling
    10·2 answers
  • Gustavo wants to buy more than two sandwiches at the city fair. There are three sandwich stands, and each is offering a differen
    6·2 answers
  • Factor x3 + x2 + x + 1 by grouping. What is the resulting expression?
    15·2 answers
  • 6 (2p + 3) + 6p = -37 + 7p
    11·1 answer
  • If Measure adc = 112 then what does bdc = ??
    11·2 answers
  • What is 50% of 50% of 50%​
    8·2 answers
  • A team is having a car wash as a fundraiser. They wash 24 cars in 3 hours. What is their unit rate in cars per hour?
    14·2 answers
  • PLEASE HELP ME ASAPPPP
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!