Diabetes insipidus is a disease characterized by excessive thirst and the excretion of large amounts of highly diluted urine, which can not be reduced by a reduction in fluid intake.
Diabetes insipidus is due to a deficiency of antidiuretic hormone or insensitivity of the kidneys to this hormone. This hormone causes water reabsorption via action on the distal segment of the nephron during dehydration.
Answer:
D) Los Alamos National Laboratory
Explanation:
Hope this helps
Answer:
A
Explanation:
The restriction enzymes cut the isolated DNA into fragments
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Mitosis is the process of cell division, where one parent cell divides to produce two genetically identical daughter cells. This process is vital in growth and tissue repair.
The reason that tissue from the fetal stage is helpful in studying mitosis is because mitosis is continuously and rapidly occurring in this phase of life in humans. The high rate of mitosis is due to the need for the fetus to grow rapidly and develop the necessary parts for it to be born.