1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
JulsSmile [24]
3 years ago
7

The first significant supporting evidence for a biological cause of a mental disorder was the 19th century discovery that the ps

ychotic disorder called general paresis was caused by the same bacterial microorganism that causes _____.
Biology
1 answer:
Karolina [17]3 years ago
6 0

Answer

               The first significant supporting evidence for a biological cause of a mental disorder was the 19th century discovery that the psychotic disorder called general paresis was caused by the same bacterial microorganism that causes <u>syphilis</u>.

Syphilis

           Syphilis is caused by bacteria “<em>Treponema pallidum</em>”. This bacteria cause infection when enter through broken skin of mucus membrane of genitals. It is sexually transmitted disease.  

General paresis

              When syphilis is untreated it lead to damaging of brain and cause a disease called general paresis in which mental activity become dysfunctional. The syphilis bacteria generally attack on brain and nervous system and begin about 10-30 years after syphilis infection.


You might be interested in
Ralph is always thirsty and recently learned that he synthesizes mutated antidiuretic hormone (ADH). Discuss why Ralph would be
Varvara68 [4.7K]

Diabetes insipidus is a disease characterized by excessive thirst and the excretion of large amounts of highly diluted urine, which can not be reduced by a reduction in fluid intake.

Diabetes insipidus is due to a deficiency of antidiuretic hormone or insensitivity of the kidneys to this hormone. This hormone causes water reabsorption via action on the distal segment of the nephron during dehydration.

3 0
3 years ago
This facility was built in 1980 to provide astronomers throughout the world an opportunity to see and collect detailed data from
zzz [600]

Answer:

D) Los Alamos National Laboratory

Explanation:

Hope this helps

3 0
2 years ago
Read 2 more answers
What occurs at step 3 in the diagram?
Ivanshal [37]

Answer:

A

Explanation:

The restriction enzymes cut the isolated DNA into fragments

5 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Why would tissue from the fetal stage of human development be used to look at mitosis?
WITCHER [35]
Mitosis is the process of cell division, where one parent cell divides to produce two genetically identical daughter cells. This process is vital in growth and tissue repair. 
The reason that tissue from the fetal stage is helpful in studying mitosis is because mitosis is continuously and rapidly occurring in this phase of life in humans. The high rate of mitosis is due to the need for the fetus to grow rapidly and develop the necessary parts for it to be born.
8 0
3 years ago
Other questions:
  • The hormone epinephrine (adrenaline) increases the pumping rate of the sodium-potassium exchange pump in skeletal muscles. how w
    5·1 answer
  • One degree of latitude on the earth's surface is equal to:
    15·1 answer
  • In 4 o’clock flowers the alleles for red and white flower color are incompletely dominant to one another and both affect the phe
    7·1 answer
  • The liquid component of of a solution is the Solvent, and the solid component of a solution is the solute.
    6·1 answer
  • What does a cell copy in dna replication?
    6·1 answer
  • Why do scientists break earth's history down into smaller pieces​
    5·1 answer
  • Can plz hurry i have a 1 hr
    14·1 answer
  • What is photosynthesis?​
    11·2 answers
  • The somatic nervous system controls
    15·1 answer
  • which statement is true about the evolution of maximum body mass of mammals after the cretaceous-paleogene mass extinction?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!