1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valkas [14]
3 years ago
12

Which of the following is total energy expenditure?

Biology
1 answer:
elena-14-01-66 [18.8K]3 years ago
4 0

Answer: Total energy expenditure can be defined in terms of the following three components: basal and resting metabolic rates; thermic effect of food (dietary thermogenesis); and physical activity (spontaneous physical activity and other physical activities of daily living).

Explanation:

You might be interested in
Which statement best explains the relationship between producer and consumers in terms of energy?
Tasya [4]

Answer:

C

Explanation:

Consumers can't convert glucose, they don't take in carbon dioxide, and they can't produce Glucose, therefore it has to be C

4 0
3 years ago
Help please thanks..​
jasenka [17]

Answer:

7) the environment is hypotonic because it is less concentrated than the inside of the cell

8.)the mass would decrease because the stuff inside the cell (which is more concentrated in comparison) would diffuse across the cell membrane into the environment in order to maintain equilibrium

9.) Diffusion in order to maintain equilibrium (moving things across a barrier from a more concentrated area to a less concentrated area in order to have an equal concentration on each side) does not require energy. However, moving matter out of the cell in Diagram C would require energy because it involves moving mass from a less concentrated area to a more concentrated area.

Explanation:

5 0
2 years ago
(It's an animal kingdom thing, Whoever answers will get brainliest answer!!)
pogonyaev

Im 90% sure that the Green anole and Box turtle are the most closely related..

5 0
3 years ago
Read 2 more answers
PLS help!!!!!! brainliest!!!! which activity produces an action potential in nerve cells?
olga55 [171]

Answer:

C. release of neurotransmitters

Explanation:

The action potential is an explosion of electrical activity that is created by a depolarizing current. This means that some event (a stimulus) causes the resting potential to move toward 0 mV. When the depolarization reaches about -55 mV a neuron will fire an action potential.

7 0
3 years ago
The steps of the dna ladder are made of _____?
Oxana [17]
The basic steps of a DNA ladder are made up of nucleotids
8 0
3 years ago
Read 2 more answers
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which molecules are able to pass through the semi-permeable membrane
    5·1 answer
  • What makes cell differentiation possible?​
    8·2 answers
  • Your 83-year-old uncle has always been an entertaining storyteller. In the past few years, he has been having difficulty remembe
    7·2 answers
  • Can someone figure this out please cus I'm totally lost on this one​
    15·1 answer
  • At what depth below sea level do you begin to observe evidence of tectonic<br> activity
    13·1 answer
  • 100 POINTS! AND GIVE EXPLANATION!
    9·2 answers
  • What is the expanded portion of a longitudinal wave
    6·1 answer
  • Even though an organism's outside environment may change,conditions inside an organism's body must stay the same in order for th
    5·1 answer
  • Where does a thought go when it's forgotten?
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!