Cell Membrane pump works to regulate the Sodium and Potassium. The channel will open and allow Sodium in while releasing Potassium.
Im pretty sure its hypothesis
Answer:
C. This is an example of VNTRs.
Explanation:
VNTRs are Variable Number Tandem Repeats. These are short sequences of DNA repeated in tandem (that is, the sequences are repeated one next to the other) a certain number of times. Unrelated individuals have a different number of repetitions for a certain region of the DNA, therefore the total length of the fragment is variable among individuals, depending on how many times the short sequence is repeated.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
The correct answer would be A. The number of neutrons present in Krypton-82 would be 46. The atomic number of an atom represents the number of protons present while the mass number is the sum of the neutrons and protons in the atom. The mass number for the given atom is 82. So, 82-36 = 46 neutrons present.
