Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
Answer:
Fibrous is the type of joint involved.
Explanation:
Diarthrosis is present at articulating bones which is responsible for the movement. Surrounding synovial capsules identifies it. synovial capsules which secretes synovial fluids to nourish and lubricate the joints while it acts as a shock absorber, surrounds the bones of synovial joints.
Smooth, hyaline cartilages which is of glass like, reduces the friction while movement and are present at the lower of the joint bones. this synovial cavity and regular, dense connective tissue which is responsible for the formation of articular capsules related with accessory ligaments.
Answer:
The large intestine
Explanation:
The large intestine is a long, tube-like organ connected to both the small intestine and the anus. In an anatomy drawing, it looks almost as if it is wrapped around the small intestine.
As we can see in the drawing, the organ labelled with 5 is wrapped around another organ which is smaller and looks longer. This smaller organ is the <em>small intestine</em>. Since we know that the large intestine <em>wraps around</em> the small intestine, we can infer that the organ is the large intestine.
Hopefully that was helpful! :)
Keystone predators effect their habitat by keeping the population of animals down.
Answer:
<em>Geographic isolation</em>
Explanation:
Geographic isolation can be described as a term that describes the model of speciation in which a biological population becomes isolated from other members of the population and can no longer have gene flow with them.
The same scenario of gene isolation is occurring in the species of taods which live at the top of the mountains in southern Arizona. This population has become reproductively isolated fro all other species of toads within the mountain range.