1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krek1111 [17]
3 years ago
6

Which food provides the most energy for the body in the shortest amount of time?

Biology
1 answer:
77julia77 [94]3 years ago
7 0
There are five classes of food, out of this five only two provides energy; these are carbohydrate and fat and oil. Out of these two, carbohydrate provides the most energy for the body in the shortest time. This is the reason why glucose, which is the end product of carbohydrate is normally given to sport men during games.
You might be interested in
Which is characterized by an absence of jaws?
shusha [124]
I believe the correct answer from the choices listed above is the first option. A lamprey is characterized by an absence of jaws. This animal is have no jaws and are only full of teeth. <span>Lampreys are any jawless fish of the order Petromyzontiformes. Hope this answers the question.</span>
4 0
3 years ago
Read 2 more answers
Hello people ~
telo118 [61]

Answer:

Herkogamy

Explanation:

  • Glorious superba is a exception kind flower type
  • Unlike others flowers it's not bise xual
  • Polleniated grains can't reach stigma

Option A

8 0
2 years ago
Read 2 more answers
Why do identical twins have the same physical characteristics, whereas regular siblings are not identical?
jonny [76]
It’s because unlike twins the regular siblings aren’t born on the same date or a couple minutes apart, but rather a couple years old or younger.
8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
In which tissue system would you find root hairs and the epidermis?
spayn [35]

answer is C- lesson 4 page 11: The Dermal tissue contains the epidermis as well as root hairs.

8 0
3 years ago
Other questions:
  • A client is 12 hours post abdominal inguinal hernia repair done under general anesthesia. the practitioner orders to progress di
    13·1 answer
  • Which of the following is not one of the three major macromolecule components for food?
    9·2 answers
  • Name this phase of mitosis *
    13·2 answers
  • An interaction in which one organism captures and feeds on another organism is called
    12·2 answers
  • Does grain size determine the porosity of a sediment type?
    9·1 answer
  • What shape is the sky?​
    10·2 answers
  • Can someone please help me with this
    13·1 answer
  • What is the answer please help no links I will report
    15·1 answer
  • Is it possible for social experience to make someone homosexual, or are homosexuals born with such a tendency? Then discuss how
    13·1 answer
  • Investigation Question: How does air get energy?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!