1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
IrinaK [193]
4 years ago
5

What happens at the end of transcription? -apex

Biology
2 answers:
zubka84 [21]4 years ago
4 0

Answer:

A: the transription process stops

Explanation:

nadezda [96]4 years ago
3 0

Answer:

<em>The correct option is C) the transcription process stops.</em>

Explanation:

At the end of transcription, the mRNA is generated and the process of transcription stops. Transcription can be described as the process by which mRNA is made form the DNA. After the process of transcription ends, the mRNA is transported to the ribosomes of the RER, where it is translated into the amino acids which join through peptide bonds to form proteins.

You might be interested in
How many eyes do spiders have?
nignag [31]
Most have eight but some have as many as twelve.
4 0
4 years ago
Read 2 more answers
Which area of the respiratory system is vascularized with the richest capillary network in the body?​
elena-14-01-66 [18.8K]

Answer:

There are from 200-500 million alveoli (mean diameter = 200 micrometers) in adult human lungs

Explanation:

The epithelial cells of the alveolar septum are markedly thinned and the capillary network immediately beneath the epithelium is the richest in the body.hope this helps you :)

3 0
3 years ago
Read 2 more answers
What does the immune system protect the body against?
lilavasa [31]

Answer:

The answer is c

Explanation:

the the immune system protects the body against harmful pathogens by producing special proteins called antibodies.

7 0
3 years ago
Read 2 more answers
describe what would happen if the photosynthesis and cell respiration didn’t perform their roles in the carbon cycle? What would
Drupady [299]

Answer: Whether the culprit were too much sunlight or not enough, if photosynthesis stopped, plants would stop converting carbon dioxide -- an air pollutant -- to organic material.

Explanation:

4 0
3 years ago
Which human body systems are involved in thermoregulation
ValentinkaMS [17]

Answer: The nervous system of human body is responsible for thermoregulation.

Explanation:

Thermoregulation is the process whereby an organism maintain its internal temperature despite changes in External temperature. The nervous system of human body is responsible for thermo regulation. The nervous system consist of nerves cells and fibres which send nerves impulses to the body parts. It comprises of central nervous system and peripheral nervous system. The centsl nervous system consist of brain and spinal cord while the peripheral nervous system consist of nerves. A part of the brain (central nervous system)called hypothalamus controls thermo regulation. When it senses a change in internal temperature of the body, its send signals to the organs, muscles, glands and nervous system , they respond differently so as to restore the body temperature to its normal one.

8 0
4 years ago
Other questions:
  • In which state do particles vibrate in place?
    10·1 answer
  • Check all of the statements that are true regarding keratinized stratified squamous epithelium.
    12·1 answer
  • What kinds of animals usually live in the areas often represented by the blue map?
    8·2 answers
  • Besides changes to the amount of water, what environmental changes would
    9·1 answer
  • What is the answer to this question
    7·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Juanita fills the tank with water so that it is 1 foot deep. What is the volume of the water?
    8·1 answer
  • I will mark brainest if you get it right
    10·2 answers
  • Which layer of the Earth do we obtain resources from?
    7·2 answers
  • This hormone is released very early and very late during the ovarian cycle: ____________
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!