1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
4 years ago
15

An X-linked gene produces spots on some platyfish. All platyfish have an autosomal repressor that inhibits the expression of the

spot-producing gene. The closely related swordtail lacks both the spot-producing gene and the repressor. In backcrosses between these two species, some hybrids receive the spot-producing gene but not the repressor. These individuals can develop malignant tumors, because the expression of the spot-producing gene is not properly regulated. This appears to be an example of__________.
Biology
1 answer:
Svetach [21]4 years ago
8 0

Answer:

The correct answer is - The Dobzhansky-Muller Model.

Explanation:

The Dobzhansky- muller model is a model that explains about how the natural selection influences speciation or reproductive isolation in a specific process when hybridization takes place between 2 species of an organism.

The offspring that produce through this process is an incompatibility with other species of origin. In the given question, spotted platyfish that arise due to the X linked gene exhibits the Dobzhansky-muller model.

Thus, the correct answer is - The Dobzhansky-Muller Model.

You might be interested in
What is the difference between a habitat and an ecosystem?
Mariulka [41]
Hope this helps !! :) good luck
3 0
4 years ago
Read 2 more answers
Multicellular plants had to develop a _____ system to move nutrients around its body.
11Alexandr11 [23.1K]

Answer:

Vascular System

Explanation:

7 0
3 years ago
Look at the diagram above of a marine food web. What might happen to this ecosystem if the non-native populations of smelt and a
Y_Kistochka [10]

The salmon will not starve as its prey increased.

The smelt is not the predator of the alewife.

The answer is D.

4 0
4 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
Do you think you would have some genetic traits similar to your grandparents? Explain your answer.
Reptile [31]

Yes, I think I have some genetic traits which is similar to my grandparents.  

Explanation:

Genes are blue print of our body. The 25% gene of Grandparent is similar to their grandchildren. This gene effects the look.  It may affect the color of hair and color of eyes.

Each gene is responsible for different change of our body. Genes pass from one generation to other so it is passed through grandparents to parents and reaches to us.  

5 0
4 years ago
Other questions:
  • In an experimental situation, a virus is injected into a rabbit and the rabbit makes antibodies against the viral antigen. These
    7·1 answer
  • A client who has a history of untreated cervicitis tells the nurse that she is concerned about the risk of experiencing problems
    15·1 answer
  • How are viruses different from bacteria? A) Bacteria are heterotrophic while viruses are autotrophic. B) Bacteria are living org
    15·2 answers
  • Which of the following is always true of animals that are products of sexual reproduction
    5·2 answers
  • Free 10<br>Have a good day <br>:^D
    10·1 answer
  • Look at the diagrams modeling some of the body systems.
    6·2 answers
  • Coal is a fuel before it is burnt<br> A.chemical energy B.electric potential energy C.heat energy​
    10·1 answer
  • Which unit of geologic time began 65.5 million years ago and continues to the present?
    13·1 answer
  • If you stab a cereal box does that mean your a cereal killer
    6·1 answer
  • a cell contains a 4% concentration of salt. the cells enviornment is isotonic. which is a possible salt concentration outside th
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!