1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goshia [24]
3 years ago
12

How does society affect us?​

Biology
1 answer:
Cerrena [4.2K]3 years ago
5 0

There are a number of reasons why people allow social influences to affect their thoughts and behavior. One reason is that we often conform to the norms of a group to gain acceptance of its members. ... Additionally, group conformity enables a sense of cohesion within a society.

have a great dayyyy

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
What two characteristics do fungi lack that forced them to become decomposers?? Please help :) **25 points**
Tamiku [17]
Fungi lacks the ability to produce their own food because they do not have chloroplast which is needed to obtain energy from the sun and convert it into food. Also fungi lack ability to fix nitrogen which has to be incorporated into their food. They also can not fix carbon and utilize it to produce food. Because of these they have to depend on dead organic matters for food.
4 0
3 years ago
What are bar graphs similar to? need answers quick pls
LenKa [72]

Answer:

Explanation:

A bar graph is very similar to a line graph in the sense that it is designed to show different values of two or more subjects but instead of using lines it using horizontal and vertical bars that represent a different value.

3 0
3 years ago
Read 2 more answers
Auxins _____.promote cell elongation and cell division in stemsstimulates seed growth and fruit developmentpromotes cell divisio
jeyben [28]

Answer: Auxins promote cell elongation and cell division in stems.

5 0
3 years ago
Based upon the data for the other locations (ex. Tulle Well or Christmas Pass etc.) What color mice would you predict would be m
denis23 [38]

Answer:

without the graph presenting the data you can't really answer this but I assume since o Neil pass has a green environment the mice would be brown to match the ground

5 0
3 years ago
Other questions:
  • This is a liquid fuel derived from plant materials​
    7·2 answers
  • C6H12O6 is a type of .Glucose has _____ carbon atoms. A) 12 B) 6
    10·2 answers
  • which of the following is not true about bacteria A. bacteria can be autotrophs or heterotrophs, B. bacteria are prokaryotes C.
    5·2 answers
  • Penny measured the time that it took her rat to run through a maze. She conducted the experiment 10 times and recorded the set o
    10·2 answers
  • Review the graphic. which point would most likely be windy?<br>A, B, or C
    9·1 answer
  • Which of the following would become a positive ion before bonding? sulfur helium carbon calcium
    10·1 answer
  • If Earth did not rotate on its axis...
    9·1 answer
  • Durante el 2° período académico, los estudiantes de 7° de un colegio de Armenia estudiaron los diferentes tejidos vegetales e hi
    11·1 answer
  • Account for the result obtained on the Strip when put in strong salt solution ​
    5·1 answer
  • The example of protective food is​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!