1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
uranmaximum [27]
3 years ago
7

Question 10

Law
1 answer:
adell [148]3 years ago
7 0

Answer:

Harris County opened its Forensic Anthropology Unit which help lead to identification of Harvey and others in:

September 2006

Explanation:

It was September 2006 when Harris County opened its Forensic anthropology unit due to the very strong need for the use of a forensic anthropologic department to solve a case. This local department allowed Harris county to identify Harvey's body and many other young boys who were victims of a sexual assaulter that killed them. It was a good victory but it took them 7 years after the first case appeared.  

You might be interested in
Which statement is part of the 3R rule?
bonufazy [111]
The 3R rule states that Radial cracks form a Right angle on the Reverse side of the force. This rule enables an examiner to determine readily the side on which a window or pane of glass was broken.
5 0
3 years ago
Read 2 more answers
30 POINTS!!!!!! PLEASE HELP ME
tankabanditka [31]

Answer:

not sure might be he acquired the entire oregon territory from great britain

Explanation:

5 0
3 years ago
Read 2 more answers
In the case of Colorado v. Connelly (1986), Supreme Court Justice Brennan considered ______________ to be the strongest piece of
KIM [24]

Answer:

A Confession

Explanation:

In the case of Colorado v. Connelly (1986), Supreme Court Justice Wiliam Brennan considered A CONFESSION to be the strongest piece of evidence in a trial.

This is evident when he wrote in his dissent among other things that "Triers of fact accord confessions such heavyweight in their determination that the introduction of a confession makes the other aspects of a trial in court superfluous and the real trial, for all practical purposes, occurs when the confession is obtained."

8 0
2 years ago
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
When a voter selects candidates from multiple political parties
Natali5045456 [20]

Answer:

split ticket voting I think

5 0
3 years ago
Other questions:
  • What did Dr. Umberger do to prove Dr. Coppolino’s guilt?
    5·1 answer
  • What your favorite food says about you
    15·1 answer
  • Knock knock?
    7·2 answers
  • Politics<br><br> ssssssssssssss
    14·1 answer
  • The following people have been arrested and charged with a variety of crimes. For each case, decide whether the person should be
    15·2 answers
  • Choose a “victimless crime” such as prostitution, gambling, or recreational drug use. Do you think this victimless crime should
    14·1 answer
  • Freeeeeeeee poooooooooiiiinnnnntssss
    8·2 answers
  • Looking at a lineup of suspects to an armed robbery, Zoe is struggling to identify the man that she saw running from the scene.
    6·2 answers
  • Differential opportunity theory argues that we all have the same opportunity to commit crimes, indicating that it is something a
    12·1 answer
  • In a criminal case, who is responsible for deciding on a sentence? judge jury executioner bailiff
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!