1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
eduard
3 years ago
10

What motivates Antigone to bury Polyneices?

Biology
2 answers:
torisob [31]3 years ago
4 0
Antigone believes that Creon will not punish her for breaking his law because they are family. She also feels some type of necessity to prove to others that she and her family have not been given a curse from their sinning parents. 
erik [133]3 years ago
3 0

Loyalty to family, is the correct answer.

You might be interested in
In some places on Earth, large tectonic plates are moving toward each other and collide with great force. One such place is wher
vitfil [10]
C A Rift Valley and Volcanoes
4 0
4 years ago
Read 2 more answers
A landscaper is shopping for landscaping materials. She wants to use materials through which water flows easily.
aalyn [17]

your answers are b., travel, & E., loosely packed soil

6 0
3 years ago
Can someone tell me what I got wrong out of these 9?
Vlada [557]

Answer:not 100%

Explanation:

What we’re the options for 5 and 9

8 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
What percent of the offspring will be red, if we cross two pink tulips?
tresset_1 [31]

Answer:

50%

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • In a study of genetic variation of the Graceland gene, a researcher finds that there are two alleles in a population. In a large
    13·1 answer
  • What are the odds of seeing a rainbow?
    10·2 answers
  • After stamping your replica plates, you return to examine the results and see that there are 100 colonies on the strep nal plate
    8·1 answer
  • Could an isolated melanin granule move along an actin microfilament?
    14·1 answer
  • Which is the correct sequence of polypeptide transport in the secretory pathway?
    10·1 answer
  • Do cells without spindle fibre continue to grow into abnormal cells?
    6·1 answer
  • Hi pls help byeeeee<br> ee
    6·2 answers
  • Pls emt smart people pls answer this the best
    10·2 answers
  • What is photosynthesis<br>koi hai ​
    6·2 answers
  • Describe the way the heart is pumping and creating cardiac output,What are factors that can change cardiac output? Explain the s
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!