1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liraira [26]
3 years ago
10

When two elements bond and

Biology
2 answers:
sammy [17]3 years ago
5 0

Answer:

a

Explanation:

Inga [223]3 years ago
4 0
A. They share or give away their protons.
You might be interested in
Which patient would most likely be diagnosed with addison's disease why?
yanalaym [24]
<span>Cortisol level is low and ACTH is high. This is signs of primary adrenal insufficiency. Low cortisol caused by damage to the anterior pituitary, and ACTH is elevated to compensate.</span>
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which of these BEST describes the structural difference between the DNA of bacteria and the DNA of humans?
pantera1 [17]
C)All DNA is made of the same components so there would be no difference.
Is the answer.
5 0
3 years ago
Read 2 more answers
What does the graph show the importance of clean air?
natulia [17]

Answer:

C. Most people will die from negative health effects associated with stroke as indoor dirty air builds up.

Explanation:

<u>C is correct option</u> because it shows the highest proportion of people's death caused by stroke. On the other options are not correct due to the following reasons:

A is incorrect because it says that people have a lower risk of dying from COPD. On the other hand, the graph shows that this is 3rd most abundant cause of deaths.

B is incorrect because deaths due to lung cancer are the lowest according to the graphical illustration.

D is incorrect because the proportion of developing acute lower respiratory infection and ischemic heart disease are not the same. Deaths due to ischemic heart disease are higher than the acute lower respiratory infection.

4 0
3 years ago
Read 2 more answers
HELPPPPPPP
postnew [5]
The first diagram is the alpha helix, which is a spiral shape.

The second diagram is the beta pleated sheet which is the folded paper shape
4 0
3 years ago
Other questions:
  • A/an __________ may involve anything from a minimal exchange of information to extensive contact with the birth mother before an
    8·1 answer
  • How are traits inherited?
    13·2 answers
  • What type of chemical bond if formed when one atom loses an electron and another atom gains an electron ?
    6·2 answers
  • How many species are currently considered “critically endangered”?
    9·1 answer
  • Put these time divisions in order, from longest to shortest. eon period epoch
    15·2 answers
  • Does the cow go moo?
    7·2 answers
  • What people think about vaccine​
    14·1 answer
  • Duplication in the gene encoding a protein invalided in vision has enabled human to acquire trichromatic vision which type of mu
    9·1 answer
  • What is the function of the genetic material in the cell​
    11·1 answer
  • Paraneoplastic syndromes in cancer involve excessive production of substances by multiple means. a common substance found in exc
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!