1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vfiekz [6]
3 years ago
12

A safety plan for earthquake and volcanoes

Biology
2 answers:
coldgirl [10]3 years ago
5 0
The simple answer is, ALWAYS have an evacuation plan.
If in an earthquake stay away from cabinets, climb under a table or chair, and do the right sitting position (Hold on to your neck position.)
Hope I helped, would love if you left me a thanks! Thanks :)
Inessa [10]3 years ago
4 0
Volcanos ; go to ocean or go far away 
earthquake ; go into bath tube
You might be interested in
A person that is sleeping on her stomach rolls over so that she is now sleeping on her back. The person moved from the ________
bogdanovich [222]
Sleeping on the stomach is "prone," on the back its "supine."
4 0
3 years ago
Read 2 more answers
The parts of an organisms environment that are living or once living and interact with the organism are _____
asambeis [7]
Hello,

The answer is "ecosystem".

Reason:A ecosystem is different populations of spices that come up to a ecosystem its kind like a community only for animals.

If you need anymore help feel free to ask me!

Hope this helps!

~Nonportrit
4 0
3 years ago
explain how it helps in increasing the shelf life of fruits and vegetables based on membrane transport​
motikmotik

Answer: There are two categories of cross membrane transport, active and passive. While active transport requires energy, passive transport relies on concentration differences inside and outside of the membrane. With films that cover the outermost membrane of the fruit (the skin), this concentration gradient can be removed or slowed so membrane transport is also slowed and as a result, the fruit stays fresh longer. A good analogy for this is considering evaporation in an open jar on a hot day versus if there was a lid on the jar. Both jars would be in the same conditions, but the jar with the lid would retain more water.

Explanation: have a great day:)

8 0
2 years ago
The temperature at which half of the dna helical structure is lost is called the:
astraxan [27]
Hi the answer is called the Tm.
Hope this helps.
6 0
3 years ago
In genereal, what plant structure would have the most chloroplasts?
Bingel [31]
Leaves would have most chloroplasts
7 0
4 years ago
Read 2 more answers
Other questions:
  • about how much time has passed between the signing of the emancipation proclamation and Dr.Kings speech
    12·1 answer
  • Neutron stars, smaller than white dwarfs, are thought to be remnants of _____.
    8·1 answer
  • Humans have<br> chromosome pairs.<br> DONE
    6·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • If you have a container with hydrogen atoms and oxygen atoms in it do you automatically have water?
    15·1 answer
  • Which of these can be found in RNA but not DNA
    11·1 answer
  • Which of the following isnt true about genes? A.
    8·2 answers
  • Question 1
    15·1 answer
  • When humans plant more trees, carbon can begin entering the _______________ as carbon dioxide.
    13·1 answer
  • 1. What are the results of the relationship between the Sun, the atmosphere, and the ocean?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!