1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
melamori03 [73]
3 years ago
11

Plants in the desert

Biology
2 answers:
Alex3 years ago
5 0

Saguaro,desert marigold,golden barrel cactus

arsen [322]3 years ago
4 0
Cactus, and dessert marigold are the ones I know.....
You might be interested in
How can atmospheric nitrogen be converted to ammonium ions or nitrate ions?
Agata [3.3K]

Answer: When a plant or animal dies, or an animal voids waste products, the initial form of nitrogen is organic. Bacteria and fungi in the soil produce enzymes that convert the organic nitrogen back into inorganic ammonium ions (NH4 +). Ammonium is converted to nitrite ions (NO2 -) by soil bacteria like Nitrosomonas

Explanation: Hope it helps

much love

Brainly plz

:)

3 0
2 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
In the models above, you labelled a cell wall and flagellum only on the bacteria cell—not the animal
Zepler [3.9K]
No. animal cells are not as mobile as bacteria, which means they don’t need a flagellum. Animal cells do not need a cell wall- as the cell wall is primarily used to maintain structure, which is needed in photosynthetic plants. please give this brainliest!
3 0
3 years ago
How is groundwater formed?
Helen [10]
I think answer might be d.
3 0
3 years ago
Read 2 more answers
Hydraulic fracturing technology is used to produce nuclear power.<br> a. True<br> b. False
NikAS [45]
The answer is a.true
3 0
3 years ago
Read 2 more answers
Other questions:
  • ?in the time between meals, what organ releases glucose to help maintain normal blood glucose levels
    6·1 answer
  • Which best describes an example of genetic engineering ?
    6·2 answers
  • There are_________oxygen atoms and__________hydrogen atoms in water.
    10·1 answer
  • Which of the following has a negitive impact on biodiversity
    13·1 answer
  • Why do you think premenopausal women need more iron than<br> men of the same age?
    8·1 answer
  • Marcus is taking a hiking trip in the mountains. He sees long scratches on the rock walls. The area was most likely eroded by a
    6·1 answer
  • The cardiovascular system consists of the heart, blood vessels, and the approximately 5 liters of blood that the blood vessels t
    10·1 answer
  • Every ____ has a specific _____
    15·1 answer
  • Which of the following is NOT made up of eukaryotic cells? *
    11·1 answer
  • Which level of organization is shown in the image?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!