1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
3 years ago
5

Match each symbol with its description.

Biology
2 answers:
alukav5142 [94]3 years ago
6 0

Answer:

Female - box 2

Change - box 1

Pound - box 3

Above - box 5

Does not equal - box 4

melamori03 [73]3 years ago
3 0

Female -  ♀

Change, change in - Δ

Pound, number (aka hashtag) - #

Above, increase -  ↑

Does not equal - ≠

Hope this helped!

~Just a girl in love with Shawn Mendes

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Colored aleurone in the kernels of corn is due to the dominant allele R. The recessive allele r, when homozygous, produces color
abruzzese [7]

Answer: C. It was heterozygous for both genes.

Explanation: To produce a generation that has individuals with trait for colored aleurone in the kernels, the plant being analised has to have a dominant allele R. In the same way, to have offspring with the recessive trait, it has to carry the recessive allele r. So, the unknown plant has to be heterozygous for colored aleurone in the kernels, Rr.

The same thought can be applied to plant color: Since there are green and yellow plants, the unknown plant has to be heterozygous for that trait, Yy.

In conclusion, the unknown plant is heterozygous for both genes.

4 0
3 years ago
Through which of these will light waves travel with the greatest speed? PLZEXPLAIN Y THE ANSWER IS CORRECT
murzikaleks [220]

Answer: The correct answer is C. Vacuum.

Explanation: It was correct on my test : )

4 0
2 years ago
A team of scientists is studying the inheritance of eyelash length in humans. Eyelash length is either long or short, and is con
son4ous [18]

Answer:

dfghjkl;lkjhgfdsadfghjhgfd

Explanation:

6 0
3 years ago
Hey! So my teacher made an escape room kinda assignment, where we have to do punnett squares questions and science questions to
Marizza181 [45]
It’s 5211 bc a is 5, B is 2 and D is 1! hope this helps!
7 0
3 years ago
Other questions:
  • What would you call a prokaryotic archaea that occupies a habitat consisting of a low ph? (you may have to think back to your ac
    13·1 answer
  • The factor being changed in a controlled experiment is called the
    8·1 answer
  • What type of venom does a cottonmouth have
    15·1 answer
  • How are DNA and RNA different
    12·1 answer
  • Muscular tissue has several important properties, such as electrical excitability. Another property of muscular tissue is that i
    11·1 answer
  • What tool does CMS require that skilled nursing facilities use to collect and to report clinical data on residents?
    6·1 answer
  • What are the roles of mRNA, tRNA, and rRNA in translation?
    13·1 answer
  • True or False Water moves from an area of low water concentration to an area of high water concentration.
    5·1 answer
  • In general, which trophic level has the MOST energy available to it? a Producer b Primary Consumer c Secondary Consumer d Tertia
    11·1 answer
  • In a pcr reaction, the strands of dna are first separated by ___.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!