1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
finlep [7]
3 years ago
15

T: Parasites rarely kill their hosts right. Instead they keep them alive as long as needed. In fact, the best parasites never ac

tually kill their hosts, though they may weaken them significantly. Explain why parasites would not want to kill their hosts immediatel
Biology
1 answer:
Schach [20]3 years ago
7 0

Parasites would want to keep their hosts alive because they cannot survive without one. Without a host, parasites will die off, meaning that they wouldn’t want to kill off their hosts, after all, that would kill them too.

You might be interested in
Antipsychotic drugs (intended to relieve schizophrenia) act by doing what?
Debora [2.8K]
<span>Anti­psychotic drugs generally work by blocking a specific subtype of the dopamine receptor, known as the D2 receptor. This helps to regulate the functioning of brain circuits that control thinking, mood, and perception.</span>
7 0
3 years ago
What are the 6 regions of the<br> human body from which hair can<br> be derived?
FromTheMoon [43]

Answer:

Hair is made of a tough protein called keratin. A hair follicle anchors each hair into the skin. The hair bulb forms the base of the hair follicle. ... Blood vessels nourish the cells in the hair bulb, and deliver hormones that modify hair growth and structure at different times of life, if that answers your question.

Explanation:

6 0
3 years ago
(03.02 LC)Which of the following correctly describes the law of conservation of energy?
kodGreya [7K]

The law of conservation of energy is a law of science that states that energy cannot be created or destroyed, but only changed from one form into another or transferred from one object to another. Hope it helps


5 0
3 years ago
Read 2 more answers
HELP 100 points<br> WHAT IS THE SCIENTIFIC NAME FOR A PIG
Anit [1.1K]

Answer:

Sus domesticus

Explanation:

4 0
2 years ago
What is pushing apart North America and Eurasia?
Slav-nsk [51]

Answer:

The North American and Eurasian Plates are moving away from each other along the line of the Mid Atlantic Ridge. The Ridge extends into the South Atlantic Ocean between the South American and African Plates.

4 0
3 years ago
Other questions:
  • Staphylothermus marinus is an extremophile archaean that inhabits deep oceanic hydrothermal vents at temperatures near boiling.
    7·1 answer
  • Which of the following would most likely be key to gathering evidence that the "RNA World" hypothesis is valid? (2 points) Creat
    9·2 answers
  • Light is one of the forms of electromagnetic energy. true or false?
    13·1 answer
  • 15points+brainliest to whoever answers right!! please help it’s due tonight :(!
    13·1 answer
  • Which describes a condition that is least favorable for conducting an ipo?
    5·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What is ALWAYS used with the codon chart to determine the sequence of amino acids?
    7·2 answers
  • This energy is released when the bonds are
    10·1 answer
  • I just bombed this test and i have 1 retake left. please help!!
    6·1 answer
  • In the water cycle, the process of occurs between the processes of evaporation and precipitation.​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!