Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
Answer:
Mold fossils A fossilized impression made in the substrate; a negative image of the organism.
Cast fossils Formed when a mold is filled in.
Trace fossils or Ichnofossils Fossilized nests, gastroliths, burrows, footprints, etc.
True form fossils Fossils of the actual animal or animal part.
For Hypothalamo-Pituitary-Adrenal Axis of endocrine gland secretion, follow the root "CORTI" (C). This will be a great memory tool. Also, nearly all hypothalamic hormones that stimulate anterior pituitary secretion have the word RELEASING (hence "R" in their acronyms). So if asked what secretes CRH, GnRH, TRH, or GHRH... the answer will be the Hypothalamus because of the R.
Now... back to CRH... we're following the "C" for CORTI. What other endocrine hormone has C for CORTI??
ACTH = Adreno[Corti]coTropic Hormone
Which will then stimulate secretion of [Corti]sol (a glucocorticoid), amongst others from the cortex of the adrenal gland. Notice the [Corti] follows the whole pathway from Hypothalamus to adrenal Cortex: Hypothal. (CRH) --> Ant. Pituit. (ACTH) --> Adrenal Cortex (Cortisol)
Sorry this was so long-winded, but I was hoping to help you grasp a portion of how the Endocrine System works!
Good luck and hmu should you have any further Anatomy/Physiology questions.
Answer:
Explanation:
Carbon can be continuously cycled, but energy cannot
Carbon in the feces of a top predator can be decomposed and used by primary producers in the form of CO2; the energy in the feces is used by the decomposers and is released as heat.
