1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
belka [17]
3 years ago
13

How might a persons current shopping habits affect the quality of the environment 100 years in the future?

Biology
1 answer:
m_a_m_a [10]3 years ago
7 0

Answer:

If many people buy plastic products, these products will still be around 100 years from now, piled in landfills or other storage sites.

Explanation:

You might be interested in
Which nucleic acid is pictured on the right? Justify your answer.
alukav5142 [94]

Answer:

Nucleic Acids:

- Uracil

- Adenine

- Guanine

- Cytosine

Explanation:

Since we only have one strand shown, I'm going to assume it is RNA. Both DNA and RNA have nucleic acids, but RNA has 1 different nucleic acid; it replaces Thymine with Uracil. So the 4 nucleic acids are uracil, adenine, guanine, and cytosine.

If the picture shown is a cross-section of DNA, then our 4 nucleic acids are adenine, thymine, guanine, and cytosine.

6 0
3 years ago
Read 2 more answers
Which of these elements is found in both carbohydrates and water?
Nimfa-mama [501]
The answer is hydrogen and oxygen
8 0
4 years ago
Read 2 more answers
Earth’s thin, rocky outer layer is its
liraira [26]
Earth’s thin, rocky outer layer is its crust. A small example is like a crust on a piece of bread. :) 

C is your answer 

7 0
4 years ago
Read 2 more answers
Describe how the earth maintains greenhouse effect ?<br>​
GarryVolchara [31]

Answer:

The greenhouse effect is a natural process that warms the Earth's surface. When the Sun's energy reaches the Earth's atmosphere, some of it is reflected back to space and the rest is absorbed and re-radiated by greenhouse gases. ... The absorbed energy warms the atmosphere and the surface of the Earth.

6 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Nitrogen-fixing bacteria remove nitrogen from plants and return it to the soil. true or false?
    15·1 answer
  • A 33-year-old pregnant client asks the nurse about testing for birth defects that are safe for both her and her fetus. which tes
    6·1 answer
  • What could account for the differences in lines A and B in the graph
    15·1 answer
  • Please help 10 points
    10·1 answer
  • What anatomical similarities do humans share with apes?
    14·1 answer
  • The main difference between commercial and noncommercial operations is
    15·1 answer
  • By which process do plants lose their water to the atmosphere?
    5·1 answer
  • Which of the following are produced from photosynthesis?
    13·1 answer
  • Depending on the organism the number of in a cell may change
    5·1 answer
  • Along with the kidneys, the ureters, bladder, and urethra make up the urinary system. Match each function or description to the
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!