1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
13

Compare the stucture of a food web with a food chain

Biology
1 answer:
zvonat [6]3 years ago
7 0

 food chain:The simplest representation of energy in a community. At the base is energy stored in plants, which are eaten by small organisms, which in turn are eaten by progressively larger organisms; the food chain is an oversimplification in that most animals do not eat only one type of organism.  

------------------  

food web:the interconnected feeding relationships in an ecosystem. These relationships can be complex; some organisms may feed on more than one trophic level, or changes may occur depending on a species' life history stages or the availability of food.

You might be interested in
What did darwin use to describe the ability of an individual to survive andreproduceinitsspecificenvironment?
Rudiy27
Darwin believed in Darwinism which is a theory of biological evolution stating that all species of organisms arise through a process called natural selection to compete, survive, and reproduce
8 0
3 years ago
Which statement best distinguishes the light-dependent (L-D) reactions from the light-independent (L-IND) reactions? The L-D rea
vazorg [7]
Go with the first option.
8 0
3 years ago
Read 2 more answers
the acceleration due to gravity on the surface of mars is about one third the acceleration due to gravity on earths surface. the
SSSSS [86.1K]
If gravity is one third on mars then weight also one third on mars
3 0
4 years ago
Help I'm confused!
aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0
3 years ago
Which system controls the female reproduction system?​
CaHeK987 [17]

Answer:

i would think its the nervous system

Explanation:

6 0
4 years ago
Read 2 more answers
Other questions:
  • Match the structural formula to the chemical formula for this substance.
    14·2 answers
  • In a forest, a tree falls on a swamp and kills the worm population reducing the population by half. The remaining population is
    10·2 answers
  • The fossils found of organisms that lived 3700 million years ago were aerobic or anaerobic?
    8·1 answer
  • Please help me with this sheet :( i need this so bad. i will reward lots of points
    15·1 answer
  • Which organelle uses nutrients like sugar and makes energy for the cell to live?
    13·2 answers
  • In the context of psychology’s scientific method, a theory is defined as: a. an attempt to test behavior and thought processes.
    9·1 answer
  • Imagine that a lizard inhabits a desert where it has very few natural predators. During a year when resources are scarce, the li
    11·1 answer
  • NEED HELP NOW. A chemical reaction occurs that involves combining 1 atom of zinc with 2 atoms hydrogen and 2 atoms of chlorine.
    6·1 answer
  • How do you think Madison's and Jefferson's views were used to justify secession and the Civil War about 60 years later?
    11·1 answer
  • Graph A above demonstrates that the rate of photosynthesis
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!