1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MaRussiya [10]
3 years ago
6

Which nucleotide could be added to the sequence

Biology
2 answers:
AlekseyPX3 years ago
5 0
The correct answer among all the other choices is C. adrenaline. This nucleotide could be added to the sequence A—G—A—T—G—C—G—A—G—T—T—A—C—G—G to create a mutation. Thank you for posting your question. I hope this answer helped you. Let me know if you need more help. 
Liono4ka [1.6K]3 years ago
4 0
I think its A, thymine
You might be interested in
Do you know any clever ways to repurpose leftover banana peels?
baherus [9]
Blend the banana peels with coffe grounds and egg shells to make a homemade fertilizer!
5 0
2 years ago
What can be observed only by observing its affect on gravity
mylen [45]

Answer:

Dark matter

Explanation:

Without dark matter the world can not be held together

4 0
3 years ago
All the different plant populations make up the plant ?
Karo-lina-s [1.5K]

All the different plant populations make up the plant community in this swamp. The plants are part of a bigger ecosystem that contains many abiotic and biotic factors.

<h3>What is an Ecosystem?</h3>

An ecosystem may be defined as a place or an area that involves individuals of different species that live together and interact with one another for the purpose of food, shelter, and space.

In ecology, a community may be defined as a group of individuals belonging to different species that are living in the same area at a given time.

So, all the different plant populations make up a plant community.

Therefore, the community is the collection of all different forms of species but the ecosystem is the community has highly influenced by abiotic and biotic factors.

To learn more about Ecosystem, refer to the link:

brainly.com/question/7413811

#SPJ1

6 0
1 year ago
Based on the data, which gummy bear was in the salt solution and what was the tonicity of that solution? A) A; hypotonic B) D; h
Lady_Fox [76]

Answer: The correct answer is D

C Hypertonic

Explanation:

7 0
2 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Which of the following is the correct formula for the compound disulfur pentoxide?
    15·1 answer
  • In north america, the main sources of protein are ________.
    15·1 answer
  • Describe the 3 stages of photosynthesis and were they take place in the cell?
    10·1 answer
  • Many enzymes in both prokaryotic and eukaryotic cells are compartmentalized within organelles. True or false?
    7·1 answer
  • The factor that is kept the same in an experiment is _________________.
    15·2 answers
  • What type of cells are produced during meiosis?
    12·2 answers
  • What microscopic structures make up organisms such as humans (you)?
    6·2 answers
  • Punnett squares use mathematical probability to help predict the genotype and phenotype combinations in genetic crosses. Select
    8·1 answer
  • Can someone help me with this question plss
    15·1 answer
  • What are the monomers, or the building blocks of DNA called?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!