Answer: Gender identity
Explanation:
Gender identity is how a person sees themselves their own internal sense and personal experience of gender. Only the individual can determine their own gender identity. Gender indentity refers to the degree to which we see ourselves as feminine, masculine, transsexual or perhaps even nongender and having no gender at all. Gender identity occurs as a result of a combination of inherent and extrinsic or environmental factors; gender role, on the other hand, is manifested within society by observable factors such as behavior and impression
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Answer:
It is difficult to avoid a tsunami due to it being such a large volume of water that is capable of destroying a large amount of land.
Explanation:
However, even though it is difficult to avoid a tsunami, as they are extremely difficult to predict, there are ways where one can begin to prepare before it hits. One of the ways you can do this is getting to a higher ground far away from inland, avoiding downed power lines, and steering clear of buildings or bridges where large, heavy objects could fall during an aftershock.
Tsunamis are incredibly dangerous, since there is a great chance that if you get caught in one, you can drown. Since tsunamis have little to no warning when they arrive, it is always essential to be prepared when one strikes.
I hope this helped! :)
If there were injuries to the brain stem, cerebral cortex, and/or the cerebellum then one possible injury could be a seizure or lead to a concussion. another affect could be memory loss, or worse case scenario being paralyzed
