1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
insens350 [35]
3 years ago
12

Can some one help with this problem

Biology
1 answer:
galben [10]3 years ago
8 0
Evaporating water is engorged mic.
You might be interested in
What's another name for a flowering plant?
dexar [7]

Answer:

the answer is B

Explanation:

sana po makatulong

7 0
3 years ago
Saturated and unsaturated fats are examples of which organic compound
jeyben [28]

Answer:

They're both Lipids, Acids

Explanation:

5 0
3 years ago
What are the phenotypes of the F1 generation snapdragons?
AVprozaik [17]

The phenotypes of snapdragons of F1 generation had pink flowers only.

Explanation:

The crossing of snapdragon with red flowers and white flowers as well led to the production of F1 offspring of hybrid quality having pink flowers only. This F1 phenotype under goes pollination and results in F2 phenotype with a ratio of 1 red, 1 white and 2 pink flower.

This is incomplete dominance as the phenotypes of parental plant, as in the white and red flowered plant reappear in the F2 generation.  

4 0
3 years ago
An 8-kg mass is in free fall. What is the velocity of the mass after 9 seconds
charle [14.2K]
It is 0.8m/s velocity
5 0
4 years ago
g If a colony of bacteria starts with 1 bacterium and doubles in number every 20 ​minutes, how many bacteria will the colony con
Lynna [10]

Answer: 2.81 x 10∧14 baterias after 16 hours.

Explanation:

Hi, first we have to find how many 20 minute intervals are in 16 hours.

If 1 hour = 60 min, 16hours = 960 minutes (16 h x 60 min / 1 h)

If we divide the 960 minutes (16 hours) by 20 minutes we obtain 48. (960/48)

There are 48 twenty minutes intervals in 16 hours.

Now we have to apply the exponential growth formula:

P (t) = Po (1 +r) ∧t

Where:  

P (t) = population at time t  

P (0) = initial population (1)

r = growth rate (1)

t = time (48)

Replacing with the values given:

P (t) = 1 (1 + 1) ∧48= 2.81 x 10∧14

2.81 x 10∧14 baterias after 16 hours.

7 0
3 years ago
Other questions:
  • You notice that some squirrels in your neighborhood have a much darker coat color than most of the other squirrels. is this dark
    15·1 answer
  • Which statement best describes the kinds of questions science can answer?
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • A strand of mRNA that is 72 nucleotide bases long would need how many molecules of tRNA to carry amino acids
    12·1 answer
  • Answer all of these questions about cancer.
    11·1 answer
  • In what ways does conservation help reduce air pollution?
    14·1 answer
  • Give an example of mutualism and explain how it works.
    11·1 answer
  • If a person is operating a leaf blower at 110 decibels, and using a pair of noise cancelling headphones that reduces the relativ
    9·1 answer
  • Which of the following is a terrestrial planet?<br> A. Earth<br> B. Jupiter<br> C. Saturn
    9·2 answers
  • Fill in the chemical equation using the following list of chemicals: H20, O2, CO2,
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!