1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alina1380 [7]
3 years ago
10

The following data represent the monthly rent of 10 two-bedroom condos in Oviedo, Florida.

Mathematics
1 answer:
romanna [79]3 years ago
5 0

Answer:

20th percentile.

Step-by-step explanation:

Concept of a percentile:

When a value V is said to be in the xth percentile of a set, x% of the values in the set are lower than V and (100-x)% of the values in the set are higher than V.

Determine the percentile of the condo with a monthly rent of $1,150

There are 10 values.

8 are higher than $1,150.

2 are $1,150 or lower.

2/10 = 0.2 = 20%

So the condo with a monthly rent of $1,150 is in the 20th percentile.

You might be interested in
Fourth grade level. Use mental math to find 7x53
Mrrafil [7]

Answer:

371


Step-by-step explanation:


7 0
3 years ago
Read 2 more answers
A recipe requires 3 cup of cornstarch. You can only measure using 1/4 cup. How many 1/4 cups are needed in the recipe
anastassius [24]

Answer:

12

Step-by-step explanation:

to make 1 cup with 1/4 cup you need to put 4.

therefore;

number of 1/4 cups needed = 3x4=12

7 0
2 years ago
All six printing machines together can print 222 pages in a minute how many pages can each machine print per hour
Furkat [3]
The answer should be 13,320
4 0
3 years ago
In health class, Baldwin is learning about making healthy food choices. For a lesson on
xxTIMURxx [149]

Answer:

There are 3.1 fibers in rhe banana

Step-by-step explanation:

6.8-3.7=3.1

6 0
2 years ago
Zachary's soccer camp started at 11:35 A.M. They spent 55 minutes practicing defense and 2 hours and 25 minutes shooting. What t
UNO [17]

camp ended at 2:55pm


4 0
3 years ago
Read 2 more answers
Other questions:
  • 7+x/3 = 2x-5 Please help with my maths question
    14·2 answers
  • 13530 grams is equal to how many kilograms
    9·2 answers
  • Which graph represents the solution set for -4(1-x)<_-12 +2
    5·1 answer
  • 4 teammates share 5 granola bars equally draw to show how much each person gets
    11·2 answers
  • Please help!!!!!!!!!
    5·2 answers
  • A recipe for cookies calls for 2/3 of a cup of sugar per batch. Elena used 5 1/3 cups of sugar to make multiple batch of cookies
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • FREE BRAINLIEST IF YOU ANSWER CORRECTLY!! (50pts)
    8·2 answers
  • The value of n. 3n = (3^2)8
    13·1 answer
  • Please help me im begging you help me i beg u :(
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!