1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MatroZZZ [7]
3 years ago
8

What property of water allows the processes of perspiration to lower mammal temperatures and transpiration to cool leaf surfaces

?
Biology
2 answers:
Fofino [41]3 years ago
7 0

Answer:

Heat energy is required to break hydrogen bonds between water molecules, releasing water vapor during evaporative cooling.

Explanation:

I just answered it on USA Test Prep.

Maslowich3 years ago
3 0

Answer:

Higher heat of evaporation required to break hydrogen bonds

Explanation:

Water molecules are joined together by intermolecular hydrogen bonding. Evaporation of liquid water into water vapor requires extra energy to break these hydrogen bonds to separate the water molecules from each other.

Since a higher heat of evaporation is required, the water molecules absorb the heat from the skin surface or leaf surfaces during perspiration and transpiration respectively. This leaves the cooler skin and leaf surfaces behind. Therefore, the presence of intermolecular hydrogen bonds and the need for extra energy to evaporation water allow it to exhibit a cooling effect.

You might be interested in
Which of the following will be the most similar?
Ivenika [448]

Answer:

a

Explanation:

Cells are the functional units of life, this means that all living organisms are made up of cells. In multicellular organisms, cells are organized into complex structures such as tissues, organs and systems. A tissue is made up of similar cells which have the similar function. An organ is made up of several tissues while a system is made up of related organs. Example of a tissue is blood which is made up of similar cells such as red blood cells and white blood cells.

4 0
2 years ago
Read 2 more answers
Which of the following choices would be an important reason why individuals are more likely to seek treatment if they have medic
Alex17521 [72]
I’d say D. The cost of treatment becomes more affordable than with medical insurance because treatment is extremely expensive and medical insurance lowers the cost.
7 0
1 year ago
You have noted an increase in cancer rates among a local harbor seal population. You also noted an increase in the release of to
zepelin [54]
A hypothesis, it's an educated guess.
4 0
3 years ago
Read 2 more answers
It is common to use ddNTPs (dideoxynucleoside triphosphates) for sequencing DNA because, when incorporated into a growing DNA po
Aliun [14]

Answer:

B. The ddNTPs lack a 3′ hydroxyl group.

Explanation:

Dideoxynucleotides is a family of inhibitors of the DNA polymerase, its official name is 2',3' dideoxynucleotides but they are commonly called ddNTPs. One of the main characteristics of this compound is the absence of the 3'-hydroxyl group in the deoxyribose, due to the absence of this group, it is impossible to form a phosphodiester bond between nucleotides and the DNA synthesis is stopped.

4 0
3 years ago
Beneficial micro-organisms that are responsible for breaking down organic matter are called?.
Lina20 [59]
Decomposers break down organic matter.
Some examples are fungi,bacteria and protozoa.
7 0
2 years ago
Other questions:
  • How does kleptopredation relate to science?
    13·1 answer
  • Which fraction represents 25% of the offspring in a genetic cross?
    15·2 answers
  • What caused the decrease in the global human population in 1400?
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 1. How did the occurrences of the different traits change over the 30-year period? Use evidence from the graph to support your a
    9·1 answer
  • The same friend asks how long humans can live. The nurse would reply that currently the maximum life expectancy of humans appear
    8·1 answer
  • Please help! Will give Brainliest!
    13·2 answers
  • Hurricanes die when they move over land because
    13·1 answer
  • PLS HELP 20 PTS
    9·1 answer
  • What is The major function of the cell membrane?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!