1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Readme [11.4K]
3 years ago
10

Which cells of the human body are made through the process of meiosis?

Biology
2 answers:
sweet-ann [11.9K]3 years ago
8 0

Answer:

sex cells known as gametes

Explanation:

Ivan3 years ago
7 0

Answer:Meiosis in Humans. In humans, meiosis is the process by which sperm cells and egg cells are produced. In the male, meiosis takes place after puberty. Diploid cells within the testes undergo meiosis to produce haploid sperm cells with 23 chromosomes.

Explanation:

You might be interested in
3. In guinea pigs, black fur is dominant (B) while white is recessive (b). Rough fur is dominant (R
Andre45 [30]

Answer:

You will need to draw a punnett square to determine the exact genotype and ratio. Black smooth fur would be of the genotype BB/Bb and rr genotype.

Explanation:

4 0
3 years ago
A population of 200 mice contains 168 brown mice. Brown is dominant to gray. How much of the population would be h o m o z y g o
Kazeer [188]

Answer:

How much of the population would be h o m o z y g o u s dominant?

A. 84%

3 0
3 years ago
I need help with this question
Sindrei [870]

true

im pretty sure plz mark brainliest

6 0
4 years ago
Which statement best compares a trace fossil to a fossil that forms as a result of an entire organism being trapped in amber?
MatroZZZ [7]

Answer:

it is C

Explanation:

5 0
3 years ago
You arrive at the scene of a Motor Vehicle Accident. You find three patients, a 16 year old boy with a broken arm, a seventeen y
mamaluj [8]

Answer: 17 year old

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • How can atoms behave at temperatures near -273c
    13·1 answer
  • Which statement best describes how minerals are different from rocks?
    10·2 answers
  • Identify structures found in fungi. Check all that apply. produce spores contain pseudopods contain hyphae contain a fruiting bo
    7·2 answers
  • Organisms at the first trophic level in a food pyramid are:
    7·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • True or false: surveillance can be performed through either stationary or mobile means.
    11·1 answer
  • Euglenoid chloroplasts are surrounded by ______ membranes.
    7·2 answers
  • Which contributes to the lack of evidence of the Period of Heavy Bombardment on Earth?
    15·1 answer
  • What is Nuclear Fusion. ​
    5·1 answer
  • Whats the correct answer answer ASAP for brainlist
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!