1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ozzi
3 years ago
7

In absence of oxygen yeast cells can obtain energy by fermentation resulting in the production of what

Biology
1 answer:
Troyanec [42]3 years ago
4 0

Answer:

Anaerobically (in absence of oxygen), yeast cells may obtain energy by fermentation, resulting in the production of ATP, CO2 AND ETHANOL.

Explanation:

This is called ethanol fermentation or alcoholic fermentation where sugars such as glucose, fructose, and sucrose is converted into cellular energy (ATP), producing ethanol and carbon dioxide as by products.

You might be interested in
What is true about the structure or function of the plasma membrane?
Anit [1.1K]

Answer:the first one I believe!

Explanation:

Sorry if it is wrong I have already done this and I pretty sure it’s the first one!

5 0
3 years ago
Read 2 more answers
What type of weather is a warm front most likely to produce?
belka [17]
The anwser is light rain 
4 0
3 years ago
Which process connects glycolysis and citric acid cycle
Over [174]
<span>The appropriate response is acetyl CoA formation. The fiery electrons are gathered to frame NADH and FADH2. corrosive, which joins to coenzyme A, framing acetyl-CoA. enter the mitochondria and are oxidized to carbon dioxide. Mark the information and yield particles of pyruvate oxidation and Krebs cycle.</span>
7 0
3 years ago
Read 2 more answers
According to the PHS, a "significant financial interest" includes royalty income paid to an investigator and its disclosure is r
Snezhnost [94]

According to the PHS, the term "significant financial interest" includes royalty income paid to an investigator except if that income is from the investigator's current employing institution.

5 0
3 years ago
A bacterium that you isolated from pond water appears to use light for energy. Based upon this information, you inoculate the or
FinnZ [79.3K]

The question is incomplete as it does not have the options which are:

  • there was no sulfur compound added to the medium, that could be used as an electron donor.
  • no oxygen was added to the medium so the organism died.
  • there is some inhibitory chemical that is preventing the growth of the bacterium.
  • you were using the wrong type of sunlight as the energy source for the bacterium.

Answer:

There was no sulfur compound added to the medium, that could be used as an electron donor.

Explanation:

In the given question, the bacteria which are found in the pond uses light energy to use carbon dioxide and form the glucose molecule. These bacteria are known as phototrophic bacteria.

The process of photosynthesis requires an electron donor and an electron acceptor to use molecule.

The organism when provided the light and carbon dioxide artificially in a culture, the bacteria were not able to grow. The reason for this could be accounted as that there was no electron donor found in the media like sulfur which could donate the electron during the chain reaction.

Thus, the selected option is correct.

4 0
3 years ago
Other questions:
  • How is gene regulation in prokaryotes and eukaryotes similar? How is it different?? (24 Points)
    9·1 answer
  • The large winds that circle the Earth occur because the equator
    14·1 answer
  • Which of the following statements are true about freezing points are true
    9·1 answer
  • Which property of water helps to moderate temperature in organisms?<br><br> '
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Item: If a piece of lab equipment is not working properly you should
    15·1 answer
  • 6. Two pink (Rr) flowers are crossed. (RR=red, rr=white)
    14·2 answers
  • Wich make the pear troublesome?<br>A. Sclerenchyma<br>B. Collenchyma<br>C. Parenchyme​
    13·2 answers
  • T or F: Speciation leads to the creation of a new group of organisms
    14·1 answer
  • Which statement describes the ability of the cell membrane to allow various substance to move through it?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!